ID: 1198900368

View in Genome Browser
Species Human (GRCh38)
Location X:141503041-141503063
Sequence CGGCGTTCAGCGGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198900358_1198900368 23 Left 1198900358 X:141502995-141503017 CCTGCTGGATCTGGAGGAGTGGA No data
Right 1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG No data
1198900356_1198900368 24 Left 1198900356 X:141502994-141503016 CCCTGCTGGATCTGGAGGAGTGG No data
Right 1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198900368 Original CRISPR CGGCGTTCAGCGGTGGTGGA CGG Intergenic
No off target data available for this crispr