ID: 1198901885

View in Genome Browser
Species Human (GRCh38)
Location X:141519407-141519429
Sequence GTGTTGATATAAAGCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198901885_1198901888 10 Left 1198901885 X:141519407-141519429 CCTGGATGGCTTTATATCAACAC No data
Right 1198901888 X:141519440-141519462 ATAGAGCTGCTGTGTCTGTAGGG No data
1198901885_1198901887 9 Left 1198901885 X:141519407-141519429 CCTGGATGGCTTTATATCAACAC No data
Right 1198901887 X:141519439-141519461 CATAGAGCTGCTGTGTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198901885 Original CRISPR GTGTTGATATAAAGCCATCC AGG (reversed) Intergenic
No off target data available for this crispr