ID: 1198909890

View in Genome Browser
Species Human (GRCh38)
Location X:141601675-141601697
Sequence GAGAGGGCCCAGAAATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198909890_1198909893 -7 Left 1198909890 X:141601675-141601697 CCATCCTATTTCTGGGCCCTCTC 0: 1
1: 0
2: 1
3: 23
4: 315
Right 1198909893 X:141601691-141601713 CCCTCTCCTAATAATATGCCTGG 0: 6
1: 1
2: 2
3: 11
4: 78
1198909890_1198909895 -6 Left 1198909890 X:141601675-141601697 CCATCCTATTTCTGGGCCCTCTC 0: 1
1: 0
2: 1
3: 23
4: 315
Right 1198909895 X:141601692-141601714 CCTCTCCTAATAATATGCCTGGG 0: 12
1: 12
2: 6
3: 15
4: 145
1198909890_1198909896 -5 Left 1198909890 X:141601675-141601697 CCATCCTATTTCTGGGCCCTCTC 0: 1
1: 0
2: 1
3: 23
4: 315
Right 1198909896 X:141601693-141601715 CTCTCCTAATAATATGCCTGGGG 0: 3
1: 2
2: 3
3: 51
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198909890 Original CRISPR GAGAGGGCCCAGAAATAGGA TGG (reversed) Intronic
902087592 1:13875211-13875233 GAGAGGGCCCAGGAAAAGAAGGG - Intergenic
905871340 1:41406306-41406328 GAGAGTGCCCAGAAAAATGATGG + Intergenic
909320192 1:74275611-74275633 GATCTGGCCCAAAAATAGGAAGG + Intronic
909352012 1:74665152-74665174 GTGAGGGCCCAGCAAGAAGATGG + Intronic
910047065 1:82930860-82930882 GAGAGGAACCAGAAGTAGGCGGG - Intergenic
910854851 1:91685039-91685061 GAGGGGCCCCAGAAAGAGAATGG - Intronic
911734046 1:101317920-101317942 GAGAGAACCCAGAAATAAGGGGG + Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912723665 1:112040926-112040948 GAGAGGACACAGGAATAGGCAGG + Intergenic
912996110 1:114534105-114534127 GAGAGGGCCCATGAAAATGAGGG - Intergenic
913502555 1:119484420-119484442 GAGAGGGCCCAGGCATGGGATGG + Intergenic
913699728 1:121362641-121362663 GAGATGGCCCAGAGGCAGGAGGG + Intronic
914446640 1:147756497-147756519 CAGAGGGCCCAGAGATGGGCAGG + Exonic
915998708 1:160592857-160592879 GAGAGAGCCCAGAAATAAACTGG - Intergenic
916560588 1:165931280-165931302 CACAGAGCCCAGAAGTAGGAAGG - Intergenic
917635353 1:176930427-176930449 GACAGCGCCCAGCAGTAGGAGGG + Intronic
918390158 1:184051626-184051648 GAGAGGGCTCAGAAACTGGGAGG - Intergenic
920939426 1:210467498-210467520 CAGATGGCCCAGAAAAAGTAAGG - Intronic
921396901 1:214678129-214678151 GGGAGAGCAGAGAAATAGGAGGG + Intergenic
922673363 1:227532222-227532244 GAGAGGGACCAGTAGTAGGCGGG + Intergenic
923570612 1:235110260-235110282 GAATGGGCTCAGAAAAAGGAGGG - Exonic
923666806 1:236005212-236005234 GAGAAGGCCCAGATATAGGCGGG + Intronic
1063729067 10:8675387-8675409 CTTAGGGCCCAGAGATAGGATGG - Intergenic
1063856551 10:10260688-10260710 GGGAGGGAACAGAAATAGGCTGG - Intergenic
1064227475 10:13500257-13500279 GAGAGGCACCAGGAATAGGATGG - Intronic
1068261499 10:54589285-54589307 GAGAGGGAACAGAAATATTAAGG - Intronic
1069070619 10:63987655-63987677 GGTTGGTCCCAGAAATAGGATGG + Intergenic
1069774668 10:70919444-70919466 GGGAGCGCCCAGAAAGAGGCCGG - Intergenic
1070127852 10:73636207-73636229 GAGAGGGGCCAGGCACAGGATGG - Intronic
1072193189 10:93092840-93092862 GAGATGGCCCAGAACTGTGAAGG - Intergenic
1072620715 10:97077362-97077384 GAGAGCACCCAGGATTAGGAAGG - Intronic
1073099868 10:101000732-101000754 GAGTGGGCCCAGAGAGGGGAGGG + Exonic
1075063044 10:119270016-119270038 CAGAGGGAACAGCAATAGGAAGG - Intronic
1076682493 10:132180405-132180427 GACAGTGCCCAGAAAGGGGAGGG + Intronic
1077886128 11:6389640-6389662 GAGAGGGCGCGGGAGTAGGAAGG + Intergenic
1078953143 11:16158252-16158274 GAGAAGGTACAGAAATTGGAAGG - Intronic
1079396644 11:20069331-20069353 GAGAGGGGACAGAAGTAGGGAGG + Intronic
1080939480 11:36899149-36899171 GAGAGGACCCAAAGAAAGGAAGG - Intergenic
1081083056 11:38767335-38767357 GAGAGAGCCCTGAGATGGGATGG + Intergenic
1081597311 11:44467872-44467894 GAGAGGGCCAAGGAGTGGGAGGG - Intergenic
1083425308 11:62581351-62581373 GGGAGGGCTCAGACATAGTAGGG + Intronic
1083515324 11:63252250-63252272 TAGAGAACCCAGAAATAGGCTGG + Intronic
1083596640 11:63920830-63920852 GACAGGGCCCAGAAAAGGGGAGG - Intergenic
1084164521 11:67369127-67369149 GAGAGGGCTAATAACTAGGAAGG + Intronic
1088262193 11:107954793-107954815 GAGAGGTCACATATATAGGAAGG - Intronic
1090390423 11:126384026-126384048 GAGAGGGCCCTGCATTGGGAAGG - Intronic
1090400660 11:126446606-126446628 GAAAGATCCCAGAAAGAGGAGGG - Intronic
1090933907 11:131324740-131324762 CAAAGGGCACAGAGATAGGAGGG + Intergenic
1091311476 11:134578107-134578129 CAGAGGCCAAAGAAATAGGAAGG + Intergenic
1094213979 12:27921341-27921363 CAGGGGGCCCAGAAATAGCAAGG - Intergenic
1096155853 12:49341216-49341238 GAGAGGGCAGAGAAAAAGGAAGG + Intergenic
1096226097 12:49867780-49867802 GAGAGGCGTCAGAAGTAGGAAGG - Exonic
1096257664 12:50073022-50073044 GAGAGGACCCAGAATTGGGATGG + Intronic
1096777254 12:53971910-53971932 GACAGGGCTGAGAAATAGGAAGG + Intergenic
1097219279 12:57437743-57437765 ATGAGGGGCCAGAAATGGGAAGG - Intronic
1097350720 12:58545794-58545816 GGATGGGCCCAGAAACAGGATGG - Intronic
1098092744 12:66921493-66921515 CATGGGGCCCAGAAATGGGAAGG - Intergenic
1098389091 12:69950292-69950314 GAGAGGTCACAGAAGTAGGCAGG + Intronic
1098472197 12:70858245-70858267 GAAAGGGAGCAGAAATAGGTGGG - Intronic
1099876194 12:88408937-88408959 GAGTGGGCAAAGAAATGGGAGGG + Intergenic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1100723143 12:97380039-97380061 GAGAGGGACAAGAAGAAGGATGG - Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1103748636 12:123143533-123143555 GAGAGAGCCCAGGCATAAGAAGG + Intronic
1103958259 12:124591803-124591825 GTGAGGGCCCAGAAATGTCAGGG - Intergenic
1104812860 12:131628928-131628950 GGGAGGGCACAGGAATGGGAGGG - Intergenic
1105973627 13:25453810-25453832 CAGAGGGCTAAGAAATAGGCAGG + Intronic
1106062269 13:26305538-26305560 GAGAGGGACAAGAAAGAGAAAGG - Intronic
1106098455 13:26671909-26671931 CAGAGGTCAAAGAAATAGGAAGG - Exonic
1106518271 13:30473932-30473954 GAAAGAGCCCAGACATAAGAAGG + Intronic
1108013933 13:46053132-46053154 GCGATGGCCCAGAAAGGGGAGGG - Intergenic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1108738804 13:53313450-53313472 GAGAGGACAAAGAAATAGGCTGG - Intergenic
1108808290 13:54186936-54186958 CTGAGGGCCCAGAAAAAGGGAGG + Intergenic
1108811227 13:54225515-54225537 ATGAGGGGCCAGAGATAGGAGGG + Intergenic
1109148390 13:58812397-58812419 GACATGGCCCAGAAATATAAAGG - Intergenic
1110666044 13:78118535-78118557 GAGAGGACTCAGAAAAGGGAAGG + Intergenic
1111714486 13:91862986-91863008 GAGAGGGAGGAGAAAAAGGAAGG - Intronic
1112100399 13:96182779-96182801 GAGAGGCTTCAGAAATAAGAAGG - Intronic
1112636860 13:101225815-101225837 GAGAGGGCCCAAGAATGGGATGG - Intronic
1112998604 13:105604585-105604607 GTGAAGGCCCAGCAAGAGGAAGG - Intergenic
1114590455 14:23860004-23860026 GAGGGAGCCCAGAAAATGGAGGG - Intergenic
1116885746 14:50219523-50219545 GAGAGTGGGGAGAAATAGGAGGG + Intronic
1118724374 14:68618405-68618427 GAGAGGGCCTCCCAATAGGATGG - Intronic
1119449780 14:74699433-74699455 GAGAGAGCCCTGCAATAGAATGG + Intronic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121794211 14:96722214-96722236 GAGTGGCCCCAGCAATTGGAAGG - Intergenic
1202842375 14_GL000009v2_random:133789-133811 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1202911760 14_GL000194v1_random:124030-124052 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1123736381 15:23188208-23188230 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124287087 15:28411185-28411207 GAGAGGGAAGAGAAAAAGGAAGG - Intergenic
1124295614 15:28500444-28500466 GAGAGGGAAGAGAAAAAGGAAGG + Intergenic
1124834793 15:33186039-33186061 GAGAGGGCCCAGCCTTGGGAAGG - Intronic
1125106978 15:35983024-35983046 GAGAGCCTGCAGAAATAGGAAGG + Intergenic
1127429628 15:58890347-58890369 GAGAGCGCCTAGAAATTGAAAGG - Exonic
1128935723 15:71744991-71745013 GAGAGGGCACAGAAACAGTGAGG - Intronic
1129013234 15:72442004-72442026 TAGAGAGCCCAGAAATAAGGTGG - Intergenic
1129060080 15:72853774-72853796 GAAAGAGCCCAAAAATAAGATGG - Intergenic
1129694510 15:77733063-77733085 GAGAGGGACTGGAAACAGGAAGG - Intronic
1130081646 15:80739062-80739084 AAGAGTGCCCAGAAAGAGCAGGG + Intronic
1130840844 15:87700007-87700029 TAGAGGGACAAGAAATGGGAAGG + Intergenic
1131549002 15:93340173-93340195 GAGAGGGACGGGGAATAGGATGG - Intergenic
1131770375 15:95730173-95730195 GAGAGCACCCAGAGAAAGGATGG - Intergenic
1132653181 16:1030733-1030755 AAGAGAGCCCAGAACCAGGAGGG - Intergenic
1135768088 16:25195202-25195224 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1136271766 16:29152784-29152806 GAGAGGCCACAGAAAGAGAAAGG - Intergenic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1138459692 16:57140928-57140950 GAGAGGGCACAGCAAGAGGCAGG + Intronic
1139906693 16:70371215-70371237 GAGAGGGCACACATATAGGCAGG - Intronic
1140017411 16:71200922-71200944 GGGAGAGCCCAGACAGAGGAGGG - Intronic
1140947152 16:79779604-79779626 GAGATTGCCCAGAAAGAGAAAGG - Intergenic
1141668746 16:85480461-85480483 AAGAGGGCTCAGAAACAGGGTGG - Intergenic
1141784862 16:86192465-86192487 GCGAATGCCCAAAAATAGGAAGG + Intergenic
1141882195 16:86867492-86867514 GAGAGGGAGCAGAAAGAGCAAGG - Intergenic
1142252876 16:89000761-89000783 GAGGGGGCACAGACAGAGGAGGG - Intergenic
1142900473 17:3008361-3008383 GAGATGACCCAGATAGAGGAAGG - Intronic
1143447028 17:7015659-7015681 AAGGGGTCCCAGAAATCGGAAGG + Intronic
1143632310 17:8146287-8146309 AAGAGGGCCCAGAAGCAGAAGGG + Intronic
1144128837 17:12226334-12226356 AACAGGTCCCAGAAACAGGAGGG - Intergenic
1144271761 17:13624501-13624523 GGGAGGGCAGAGAAATAGGCTGG + Intergenic
1144326821 17:14190405-14190427 GAGATGGCCCAGGAACAGGTGGG + Intronic
1144475701 17:15587269-15587291 GAGATGGCCCAGGAACAGGTGGG + Intronic
1144703308 17:17352230-17352252 GAAAGGGCCCAGAAATAGCGAGG + Intergenic
1145113904 17:20190416-20190438 AAGAGGGACAAGAAATGGGAAGG - Intronic
1145752264 17:27363640-27363662 GAGAGGTCTCAGACACAGGAAGG + Intergenic
1148159575 17:45442254-45442276 GAGAGGGCTGAGACATGGGAAGG - Intronic
1148530624 17:48387328-48387350 GAGAGTGCACAGGGATAGGAGGG - Intronic
1148915921 17:50978738-50978760 GTGAGGACCCTGAAATGGGAAGG + Intronic
1151108007 17:71640642-71640664 GAGAGAGAACAGGAATAGGAGGG - Intergenic
1151387263 17:73762673-73762695 GAGCAGGCCCAGAAATAGCGTGG + Intergenic
1152043112 17:77917796-77917818 TAGAGTTCCCAGAAATGGGAGGG - Intergenic
1152121021 17:78418455-78418477 GAAAGTGCCCAGAAATCGGCAGG - Intronic
1152615013 17:81333943-81333965 GAGAGGGCCCTGCCAGAGGAAGG - Intergenic
1203166366 17_GL000205v2_random:100425-100447 GAGAGTGCCCAAGAATAAGAGGG + Intergenic
1153564969 18:6410150-6410172 GAGACGGCCCTGAGACAGGAGGG - Intronic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1157588884 18:48824078-48824100 GATAGTGCACAGAAATAGAAAGG - Intronic
1157617439 18:48995508-48995530 GGCCAGGCCCAGAAATAGGATGG + Intergenic
1158352653 18:56578706-56578728 AAGGGGACCCAGTAATAGGATGG + Intergenic
1158692164 18:59670508-59670530 GCGTGTGCCCAGTAATAGGACGG + Intronic
1158974273 18:62696712-62696734 GGCAGGGCCCAGGAAAAGGAAGG - Intergenic
1159041397 18:63326157-63326179 AAGACGGCCCAGAAACAGCAGGG - Intergenic
1159390292 18:67784229-67784251 GAGAGAGCAAAGAAATGGGAAGG + Intergenic
1160210808 18:76877013-76877035 GAGAGGCACCAGAAACAGAATGG + Intronic
1160770487 19:828724-828746 GAGGGGGCCCAGAGAAAGGAAGG + Intronic
1161640452 19:5419314-5419336 CAGAGGGACGAGGAATAGGATGG + Intergenic
1162524931 19:11201604-11201626 GAGGGAGCCCAGATCTAGGAAGG - Intronic
1163186829 19:15644744-15644766 GAGAGGGCCCCAAACTAGGCTGG - Intronic
1163197591 19:15733950-15733972 GAGGGCGCCCAGCAATGGGAGGG + Intergenic
1163769155 19:19180277-19180299 GGGAGGTCCCAGAGATAGGTGGG + Intronic
1164540604 19:29119019-29119041 GAGGAGGCCCAGAGAAAGGATGG - Intergenic
1166062131 19:40332857-40332879 GAGCGGGACCTGAAATAAGAGGG - Intronic
1167674372 19:50875323-50875345 GGGAGCACCCAGAAAAAGGAAGG + Intronic
1168266865 19:55228126-55228148 GAGAGGCCCCAGCACTTGGATGG - Intronic
1202656463 1_KI270708v1_random:27707-27729 GAGAGTGTGGAGAAATAGGAAGG + Intergenic
928205949 2:29283510-29283532 GAGAAGACCCAGAAAAAGGGTGG + Intronic
932369170 2:71173429-71173451 GAGAGGCCCAAGACTTAGGATGG + Intergenic
932613729 2:73218836-73218858 GAGAGGGCAGAGGGATAGGATGG - Intronic
932910775 2:75804085-75804107 GATAGTGCACAAAAATAGGAAGG - Intergenic
934906558 2:98210142-98210164 GAGAGGGGCCAGGAAAACGATGG - Intronic
935370625 2:102342878-102342900 GAGAGGACATAGAAAGAGGAAGG + Intronic
935463655 2:103368788-103368810 GTGAGTACCCAGAAATAAGATGG - Intergenic
935562056 2:104569439-104569461 GAGAGAGTCCAGAACAAGGAAGG - Intergenic
936167783 2:110138789-110138811 GAGAGGGCCAAGCAGAAGGAAGG - Intronic
937644647 2:124252473-124252495 GAGAGGGCTCAGAAAAAAGATGG - Intronic
938617651 2:133016064-133016086 GAGAGAGAAAAGAAATAGGAAGG + Intronic
939033109 2:137100172-137100194 GATAGTGCCAAGAAAAAGGATGG + Intronic
939413552 2:141862978-141863000 GAGAGAGCTCAGCAATAAGAAGG - Intronic
941864662 2:170322264-170322286 TTGAGGGGACAGAAATAGGAAGG - Intronic
945243475 2:207697713-207697735 GACAGGGAACAGAAGTAGGAAGG + Intergenic
945691866 2:213046514-213046536 GAGAGGGCCCTGAAATACAGTGG + Intronic
946457395 2:219838721-219838743 GGGAGGGGCCAGAAATATGTAGG - Intergenic
948737790 2:240020767-240020789 CGGAGGGCCCAGAGATAGGCCGG - Intronic
948925741 2:241095954-241095976 GAAAGGGCCCAGAGATATCAAGG - Exonic
1168805198 20:668630-668652 GGGAGGGCCCAGAAATACTTTGG + Intronic
1168964786 20:1892800-1892822 AAGAGGGCCCAGCACAAGGAGGG - Intergenic
1169058204 20:2641240-2641262 CAGGGGGCCGAGATATAGGAAGG - Exonic
1169087778 20:2838159-2838181 GACAGGGCTCAGAAACAGAATGG - Intronic
1171445331 20:25198813-25198835 GGGCTGGTCCAGAAATAGGACGG - Intronic
1172957311 20:38770117-38770139 GAAAGGGGGCAGAAACAGGAGGG - Intronic
1173337087 20:42121222-42121244 GAGCAGGCCCAGCAATTGGAAGG - Intronic
1174389862 20:50212294-50212316 GAGATGGGCCAGAAATATGGAGG - Intergenic
1175497584 20:59425235-59425257 GAGAAGGCCCAGCGAAAGGAAGG - Intergenic
1175889750 20:62310879-62310901 GTGAGGGCCGAGAAGAAGGAAGG - Intronic
1176405389 21:6358671-6358693 GAGAGTGCCCAAGAATAAGAGGG - Intergenic
1176431768 21:6630432-6630454 GAGAGTGCCCAAGAATAAGAGGG + Intergenic
1176631122 21:9138697-9138719 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1177546055 21:22560836-22560858 GGGAGAGTCCAGAAAGAGGAGGG - Intergenic
1178157806 21:29874726-29874748 GAGAAGACCCAGAACTGGGATGG + Intronic
1178423920 21:32463861-32463883 GAGCTGGCACAGAAAGAGGATGG - Intronic
1178458837 21:32782244-32782266 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1179227251 21:39465202-39465224 GACAGGGGTCAGAAATTGGAGGG - Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1184098196 22:42327973-42327995 GAGGGGGCCCAGAGCTATGATGG - Intronic
1184501825 22:44879139-44879161 GGGAGGGCCCTGAACCAGGATGG + Intergenic
1185307730 22:50130634-50130656 GAGAAGACCCAGGAATGGGAAGG + Intronic
1185390563 22:50559043-50559065 GAGAGAGCCAAGAAAGAGCAGGG - Intronic
950248339 3:11442210-11442232 GTGTGGGCCCAGAAACAGGGTGG + Intronic
951180223 3:19651143-19651165 GAGAAGGCGGAGAAATAGGAAGG + Intergenic
952503078 3:33982291-33982313 GAGTAGGCCAAGAAAGAGGAAGG - Intergenic
953435603 3:42874930-42874952 AAGAGGGCCCAGAAAGAGGTAGG + Exonic
953571906 3:44077947-44077969 GGGAGGGCCCAGAGCGAGGAGGG - Intergenic
953576175 3:44114715-44114737 GGGAGGACCTAGTAATAGGACGG + Intergenic
954696763 3:52431581-52431603 AGGAGGGGCCAGAAATAGGCTGG + Intergenic
954834771 3:53456346-53456368 AAGAGGGCAGAGAAATAGGATGG + Intergenic
955703119 3:61701900-61701922 GAGAGGGAAGAGAAAGAGGAAGG + Intronic
955813289 3:62814968-62814990 GAGAGGGACCAAAAAGAAGACGG - Intronic
955900330 3:63747022-63747044 GAGAAAGCCAAGAGATAGGAGGG - Intergenic
956435634 3:69232073-69232095 GGGAGGGCCCAAAAGTAGTAGGG + Intronic
956778433 3:72585956-72585978 GAGAGGGCCCTGGAAGAGGTGGG + Intergenic
956858931 3:73303330-73303352 GAGACTGCCTAGAAATAAGAAGG - Intergenic
959029311 3:101279527-101279549 GTAAGGTCCCAGAAAGAGGAAGG + Intronic
959543448 3:107567985-107568007 GAGAGGTCCAAGAAAGAGAATGG - Intronic
960600607 3:119454369-119454391 GAGGAGTCCCAAAAATAGGAGGG - Intronic
960639596 3:119813070-119813092 GAAAGGGCACAGGAAAAGGAGGG - Intronic
961817866 3:129560538-129560560 GATGGGGCCCAGAATCAGGAGGG - Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962436745 3:135373941-135373963 CACAGGGCCCAGACATAGGGAGG + Intergenic
962719316 3:138158020-138158042 GAGAGGGCACAAATATAGAAAGG - Intergenic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
963203566 3:142609525-142609547 GCAAGGGCCTAGAAATAAGAGGG + Intronic
964246230 3:154657112-154657134 GAGAGCCCCCAGCAATAGAAAGG + Intergenic
964342076 3:155718310-155718332 TAGAGGGCTCAGAAGAAGGAAGG - Intronic
967223421 3:187268726-187268748 TAGAGGGCCCAGAACTAGCTGGG + Intronic
967553806 3:190831446-190831468 GAGGGGGCCCTGGAAGAGGAGGG - Intergenic
971417021 4:26441071-26441093 GAGAGGTCCCAGAAATGTGGAGG + Intergenic
971943958 4:33250608-33250630 GAGACGGCCCAGGAGTGGGATGG + Intergenic
972877675 4:43384266-43384288 GAGAGTGCCCAGAATTATTATGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975069810 4:70119953-70119975 GAGAGGGCAGAGAAATATGTAGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975672429 4:76794945-76794967 AATACAGCCCAGAAATAGGATGG + Intergenic
976671074 4:87654330-87654352 ATGAGGGGCCAGAGATAGGAGGG + Intronic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980578750 4:134720726-134720748 TAGAGAGCCCAGAAATAATACGG + Intergenic
981161389 4:141503244-141503266 GTGAGGGCCCAGAAAGAAGGTGG + Intergenic
981305161 4:143239606-143239628 GAGTGCGCCCTGTAATAGGATGG - Intergenic
981525615 4:145704301-145704323 GAGAAGGCATAGAAATGGGAGGG + Intronic
982627662 4:157787754-157787776 GACAGGGACCAGAAACAGCAAGG - Intergenic
982695828 4:158599269-158599291 GTGAGGGACCAGGAAGAGGAGGG - Intronic
983069480 4:163252078-163252100 GAGAGGGCTCTGAAGTGGGAAGG + Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986138545 5:5006596-5006618 GAGAGGGGCCTGGAATAGAATGG + Intergenic
987553166 5:19410111-19410133 GAGAGAGCCCAGAAATAAAGAGG - Intergenic
988544755 5:32145020-32145042 TGGAGGGCCCAGGATTAGGAAGG + Intronic
990189412 5:53241775-53241797 GCGAGGGCCAGGAAATGGGAAGG + Intergenic
990568605 5:57055163-57055185 GAGCGGGCCCTGAAGTTGGATGG - Intergenic
992002647 5:72450868-72450890 GAGAGGCCAGAGAAAGAGGATGG + Intronic
992175092 5:74142229-74142251 GAGTGTGCCCTGAGATAGGATGG - Intergenic
995817837 5:116191755-116191777 GAGAGGGACCAGCAATGGGCAGG - Intronic
996439566 5:123474354-123474376 CAGATGGCACAGCAATAGGATGG + Intergenic
997198101 5:131993056-131993078 GAGAGGGGCCAGAGATGGGCTGG - Intronic
998056339 5:139081490-139081512 TAGAGGGCCAAGAACTAGGGAGG - Intronic
998405031 5:141869409-141869431 GGGAGGCCCCAGAATCAGGAGGG + Exonic
998601657 5:143591297-143591319 GAGAGGACCAAGAAGTAGGTGGG - Intergenic
999483583 5:151971204-151971226 GCAAAGGCCCAGAAATAAGAGGG + Intergenic
1001004745 5:168040178-168040200 GTGAGGGACTAGAAGTAGGAAGG + Intronic
1001491265 5:172157212-172157234 GGGAGGGGCCAGAAATAGGGAGG + Intronic
1001732978 5:173973755-173973777 GACAGGGCTCAGAAATTGGCTGG + Intergenic
1002072999 5:176691586-176691608 GAAAGGGCCCAGTAAAAAGAGGG + Intergenic
1002889733 6:1322065-1322087 AAGAGGGTCCAGGAATGGGAAGG - Intergenic
1003651751 6:7967249-7967271 GAGAGGGCACTGAAAGAAGAGGG + Intronic
1003684630 6:8289612-8289634 GAGAGAGAGCAGAAATTGGAAGG - Intergenic
1004388770 6:15191800-15191822 GAGACGACACAGAAATAAGAGGG - Intergenic
1006247996 6:32757229-32757251 GAGAGGGCACAGGCATAAGAGGG - Intronic
1007150437 6:39684999-39685021 GAGAGGGTCCAGAAATAAATGGG + Intronic
1007209513 6:40181099-40181121 GAGAGGGGCGAGAGACAGGAGGG - Intergenic
1008527504 6:52420834-52420856 GAGAGGGCCCAGAGATAGGTTGG - Intronic
1011658672 6:89575346-89575368 TTGAGGGGCCAGAGATAGGAGGG + Intronic
1013619148 6:111872454-111872476 GGGAGGTGCCAGAAATAGGCAGG + Intronic
1016060577 6:139625737-139625759 GAGAGGACCCTGAAGCAGGAAGG - Intergenic
1017680580 6:156859813-156859835 GAGAGGGCACAGAAAGACTAAGG + Intronic
1019543721 7:1562856-1562878 GAGCGGGCCCAGAAAGCAGAGGG + Intergenic
1020810825 7:12847764-12847786 CAGAGGGCTCAGAAAAAGAAAGG - Intergenic
1022070475 7:26908741-26908763 TAGAGAGACCAGAAATATGAAGG - Intronic
1023907243 7:44531514-44531536 GAGATGGCCCAGGCATCGGAGGG - Intronic
1023991550 7:45131905-45131927 TAGAGGGACAAGAAACAGGAGGG - Intergenic
1026460811 7:70613705-70613727 GAGGAGGCCCCTAAATAGGAGGG + Intronic
1026879091 7:73897348-73897370 AAGAGGGCACAGGCATAGGAGGG - Intergenic
1027247170 7:76375066-76375088 GAGAGGGACCAGGAAGAGCAGGG + Intergenic
1027348143 7:77282876-77282898 TATAGGTCCCAGAAATAGTATGG - Intronic
1027483728 7:78732511-78732533 GAAATGCACCAGAAATAGGATGG + Intronic
1028655462 7:93200916-93200938 GAGTGTGCCCTGAAATGGGATGG - Intronic
1029293393 7:99519668-99519690 GAGAGGATCCAGAAATTAGAGGG + Intronic
1030744239 7:113145844-113145866 AAAAGGGCTAAGAAATAGGATGG + Intergenic
1031837028 7:126690963-126690985 GGGTGGGCCCAGAAAAAGCACGG + Intronic
1032176318 7:129630409-129630431 GAGAGGGTCCTCAACTAGGATGG + Intronic
1035169382 7:157009316-157009338 GAGAGCGCCCTGAATTAGGCAGG - Intronic
1036680832 8:10872057-10872079 GAGAGGGCCCAGAACCAGCATGG + Intergenic
1036687904 8:10924095-10924117 GAGAGGGCCCAGGAGGAGGAGGG - Intronic
1039261854 8:35780448-35780470 CAGAGGGCCGAGGAAAAGGATGG + Intronic
1040279460 8:46031484-46031506 GGGAGGGGACAGAAAGAGGAGGG + Intergenic
1041797664 8:61762509-61762531 GACTGGGCCCTGCAATAGGATGG - Intergenic
1041869022 8:62612273-62612295 GAGAGCACCCAGATATAGAAAGG - Intronic
1044693456 8:94900467-94900489 GGGAGGGCCCTTAAAAAGGAAGG + Intronic
1044747083 8:95381252-95381274 AACAGGGCCCCGAATTAGGAAGG + Intergenic
1045030290 8:98128523-98128545 GAGATTGCCCAGAAAGAGGTAGG + Exonic
1045936343 8:107684026-107684048 CATAGAGCCCAGAAATATGAAGG - Intergenic
1046483278 8:114851420-114851442 GAGAGGTCCCAGAATGAGCAAGG + Intergenic
1048199096 8:132356788-132356810 GTGATGGCCCAGGAATGGGATGG + Intronic
1049262040 8:141644851-141644873 CAGGGTGCCCACAAATAGGAGGG - Intergenic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049703228 8:144024341-144024363 GAGAGGGTCCTGAAAGAAGAGGG - Intronic
1050337087 9:4599977-4599999 GTGAGGGAGCAGGAATAGGAAGG - Intronic
1051502667 9:17795204-17795226 GATAATGCCCAGAAATAGGAGGG - Intronic
1055349431 9:75371070-75371092 GAACGGGCCCAGAAAAGGGATGG - Intergenic
1056132923 9:83603110-83603132 GAGAGGACCCAGAGAGAGGGAGG - Intergenic
1059280524 9:113129680-113129702 GGGAGAGCCCAGAAATATTAAGG - Intergenic
1059364074 9:113771723-113771745 GGAAGGGCCGAGACATAGGAAGG - Intergenic
1059679054 9:116568662-116568684 GAGAGGGACCAGACTCAGGATGG - Intronic
1059856396 9:118402760-118402782 GAGATGGCTCAGAAAGAAGAAGG + Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060336966 9:122733947-122733969 TAGAGAGCCCAAAAATAAGATGG + Intergenic
1061394346 9:130335520-130335542 GAGAGGTCCCAGACATTGGCTGG + Intronic
1061826468 9:133261214-133261236 GAGCGGGCCCAGGAAGGGGAGGG + Intronic
1061872679 9:133529089-133529111 CAGAGGTCCCAGAGCTAGGATGG - Intergenic
1203439771 Un_GL000195v1:178276-178298 GAGAGTGCCCAAGAATAAGAGGG - Intergenic
1203753947 Un_GL000218v1:106313-106335 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1189219608 X:39360115-39360137 AAGAGGCCACAGAAATGGGATGG - Intergenic
1189913131 X:45830814-45830836 GAGAGGGCTGTGAAATAGGAGGG + Intergenic
1190476956 X:50837712-50837734 GAGAGGGCTCCTAAATAGGATGG + Intergenic
1192678445 X:73225343-73225365 GAATGGGCTCAGAAAAAGGAGGG + Intergenic
1194755607 X:97734964-97734986 GAGAGATCCCAAAAATAGCAAGG - Intergenic
1195031134 X:100928798-100928820 GAGCGGGCGCAGAAGAAGGAGGG + Exonic
1196375645 X:115029710-115029732 GAGAGGGCCAGGAGAGAGGAGGG - Intergenic
1196897806 X:120354867-120354889 AACAGGGCCCAGAAATTTGAAGG - Intergenic
1197745499 X:129930301-129930323 GAGTGGGCCCTGAGTTAGGAAGG - Intergenic
1198230966 X:134689117-134689139 GACAGGGACCAGAACTGGGATGG - Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198631637 X:138645399-138645421 GCCAGGGCACACAAATAGGAGGG - Intronic
1198909890 X:141601675-141601697 GAGAGGGCCCAGAAATAGGATGG - Intronic
1199229572 X:145421145-145421167 TAGAGGGCACAGAAGTAGGCAGG + Intergenic
1199998080 X:153039386-153039408 GAGAGGACACAGAAAGAGGCAGG - Intergenic
1200003606 X:153074068-153074090 GTGAGAGCCCAGACACAGGAAGG + Exonic
1200004117 X:153075941-153075963 GTGAGAGCCCAGACACAGGAAGG - Intergenic
1201167594 Y:11223960-11223982 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1202047580 Y:20749986-20750008 AAGAGGGGCCAGTGATAGGAGGG + Intergenic