ID: 1198911860

View in Genome Browser
Species Human (GRCh38)
Location X:141624001-141624023
Sequence CAAGCTTCTCATATTGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198911860_1198911863 12 Left 1198911860 X:141624001-141624023 CCAAAAACAATATGAGAAGCTTG 0: 1
1: 0
2: 0
3: 15
4: 240
Right 1198911863 X:141624036-141624058 TTGAAAATTCTAAATTTTGCTGG 0: 1
1: 0
2: 3
3: 68
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198911860 Original CRISPR CAAGCTTCTCATATTGTTTT TGG (reversed) Intronic
901167932 1:7233067-7233089 CAAGCTTCTCACATTCTGGTGGG - Intronic
901951273 1:12749245-12749267 CAAGATTCTCTCTTTGTTTTTGG - Intronic
902309187 1:15567871-15567893 AATGCTTATCATATTGGTTTGGG - Exonic
906269927 1:44468946-44468968 TGATCTTCTGATATTGTTTTTGG - Intronic
906373715 1:45276651-45276673 CAGGATTCTCATTTTGTATTTGG - Intronic
906411931 1:45585225-45585247 CAATCTTGCCATATTTTTTTAGG + Intronic
906419115 1:45648586-45648608 CAAGCCTCTTATATAGATTTTGG + Intronic
906564138 1:46784930-46784952 CAACCTTGTCATTTTATTTTAGG + Intronic
908018724 1:59877157-59877179 CAAGCTTCTCTCATTGTCTTTGG + Intergenic
908095867 1:60737728-60737750 CAAGATTATCATTTTTTTTTTGG - Intergenic
911137616 1:94458025-94458047 CCAGCTAATTATATTGTTTTGGG + Intronic
911810664 1:102275049-102275071 CAAGATTCTCTTTTTGTCTTTGG + Intergenic
911832902 1:102577403-102577425 AAATTTTCTCATAGTGTTTTTGG - Intergenic
911867141 1:103042850-103042872 CCAACTTCTCATATTCTTTTGGG - Intronic
913678266 1:121163375-121163397 CAGGCTTCTCATCTTAGTTTAGG - Intergenic
914030105 1:143951015-143951037 CAGGCTTCTCATCTTAGTTTAGG - Intronic
914159345 1:145116936-145116958 CAGGCTTCTCATCTTAGTTTAGG + Intergenic
916023381 1:160813945-160813967 ACAGCTGCTCATATTGTTTCTGG - Intronic
916277223 1:163008005-163008027 CAATCTGATCATATAGTTTTAGG - Intergenic
918252792 1:182718672-182718694 CATTTTTCTCATATTGTTCTAGG - Intergenic
918378659 1:183933561-183933583 CAAACTTCTCATTTCCTTTTGGG + Intronic
918558457 1:185834392-185834414 CAAGCTACTCACATGGTTGTTGG + Intronic
920022844 1:202968229-202968251 CAAGCTTCACATCCTGATTTGGG + Intergenic
920465573 1:206181899-206181921 CAGGCTTCTCATCTTAGTTTAGG - Intergenic
921341907 1:214142472-214142494 CAAGCTTCTGATATATTTTAGGG - Intergenic
921473022 1:215570625-215570647 CAATCTTATCAGATTGTTATAGG + Intronic
1063839281 10:10051773-10051795 AAAGTTTCGCATAATGTTTTTGG + Intergenic
1067187106 10:44039742-44039764 CAAGCTTCTGATATTTCCTTTGG - Intergenic
1067753844 10:48989287-48989309 CAAGCATCTCATGGTGCTTTAGG + Intergenic
1069310941 10:67035576-67035598 AAAGCTTCTGATAGGGTTTTTGG - Intronic
1070153454 10:73819317-73819339 CACACTTCTCATATTTCTTTGGG + Intronic
1071009808 10:80924735-80924757 CAAGCTTCTTATCTTGTTCCCGG - Intergenic
1071582241 10:86782607-86782629 GTAGCTTTTCATATTTTTTTTGG + Intronic
1071813886 10:89211494-89211516 TCAGCATCTCCTATTGTTTTTGG - Intergenic
1072293127 10:93984757-93984779 CAAGCTACTCAAATTCCTTTGGG - Intergenic
1073019477 10:100430782-100430804 GAAGCATTTCATATTGTTTGAGG - Intergenic
1077869435 11:6249750-6249772 CATCTTTCTCATATAGTTTTAGG - Intergenic
1078805907 11:14703126-14703148 CAAATTGCTCATATTTTTTTGGG + Intronic
1081546708 11:44077122-44077144 CAAGCTTTCCAAAGTGTTTTGGG + Intronic
1082702643 11:56452074-56452096 CCAGCATCTGATATTTTTTTGGG - Intergenic
1083087312 11:60163291-60163313 CAAAATTCTCATTTTGTTTCTGG + Intergenic
1084131739 11:67141220-67141242 CAATTTTTCCATATTGTTTTGGG + Intronic
1086747957 11:90453897-90453919 CAAGATTCTCATTTTCTTCTTGG - Intergenic
1087868167 11:103259515-103259537 TATTCTTGTCATATTGTTTTGGG + Intronic
1089022260 11:115228445-115228467 CCAGCTTCTCACTTTGTATTTGG - Intronic
1089861135 11:121590953-121590975 CAAGCTGCTTCTAATGTTTTGGG + Intronic
1092463116 12:8703844-8703866 AAACCATCTCATATTGTGTTTGG + Intronic
1092698977 12:11205639-11205661 CAACCCTCTAATATTGTCTTTGG + Intergenic
1092886090 12:12925745-12925767 AATGCTTCTCTTATTGTTTTTGG - Intergenic
1093327506 12:17795798-17795820 CAACCTTTTCATATTTATTTAGG - Intergenic
1095366296 12:41410500-41410522 GAGCCTTCTGATATTGTTTTGGG + Intronic
1095772743 12:45980002-45980024 TAAGCGTTTCATATTATTTTTGG + Intronic
1096932878 12:55234702-55234724 CAAGGTTCTCTTTTTGTCTTTGG - Intergenic
1097537102 12:60886009-60886031 CCAGCTTCACAGAATGTTTTAGG + Intergenic
1099349040 12:81541868-81541890 CAGGCTTCTCATATTGGAGTTGG + Intronic
1100943402 12:99750419-99750441 CAAGCTTTTCCTATAGTTATAGG - Intronic
1101074398 12:101113301-101113323 AAAGGTTCCCATTTTGTTTTTGG - Intronic
1101484682 12:105142387-105142409 CATTCCTTTCATATTGTTTTGGG + Intronic
1102622997 12:114211577-114211599 CAAGCATCCCATATGGTTCTTGG - Intergenic
1103118617 12:118361065-118361087 CAAGCTTCTGATGTTAATTTAGG - Intronic
1103199748 12:119078080-119078102 CAAGCTGCTTATGTTGTCTTTGG - Intronic
1104505850 12:129331504-129331526 CCAGCTTCTCATTTTGCTTTGGG - Intronic
1104984622 12:132589700-132589722 AAAGCTTCACATATAATTTTAGG - Intergenic
1107367705 13:39702289-39702311 AAAGCTTCCCAGTTTGTTTTAGG + Intronic
1108981081 13:56515384-56515406 CATGATTGTCATATAGTTTTAGG + Intergenic
1108992338 13:56676065-56676087 CAAGATTCTCATTTTTTCTTTGG + Intergenic
1110697426 13:78507699-78507721 CAAGCTTTTCACATTTTATTTGG + Intergenic
1111523774 13:89440290-89440312 CAAACCTATCAAATTGTTTTTGG - Intergenic
1112079092 13:95948330-95948352 CAGGCTACTCATCTTCTTTTTGG + Intronic
1113715195 13:112500055-112500077 AAAGCCTCTCATATTTTGTTGGG - Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114127214 14:19742800-19742822 CACACTTTTCATATTCTTTTTGG + Intronic
1114129187 14:19770567-19770589 TGAGCTTCTCATTTTGTTCTTGG + Intronic
1115520574 14:34229296-34229318 CAATCTTCTCAAGTTGGTTTTGG - Intronic
1115634144 14:35275111-35275133 AAAGTTTCTTATATTGATTTGGG + Intronic
1117556612 14:56892872-56892894 CCAGCTTCTTGTATTGTCTTGGG - Intergenic
1118639675 14:67780604-67780626 CATGCTTCCCAGATTGTTCTGGG + Intronic
1120003988 14:79336132-79336154 CAAGATTCTCTGATTGTTTTTGG - Intronic
1120223675 14:81765787-81765809 CAAGTTTCTCTTTTGGTTTTTGG - Intergenic
1120464209 14:84835116-84835138 CAAACTACTCATTTTTTTTTAGG - Intergenic
1120493119 14:85201984-85202006 CCAGCTTCTCAGATTGTCTTGGG - Intergenic
1120578326 14:86212587-86212609 CAATCATCTCAGTTTGTTTTGGG - Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123570669 15:21604441-21604463 CACACTTTTCATATTCTTTTTGG + Intergenic
1123572138 15:21624787-21624809 TGAGCTTCTCATTTTGTTCTTGG + Intergenic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1123606782 15:22039794-22039816 CACACTTTTCATATTCTTTTTGG + Intergenic
1123608753 15:22067374-22067396 TGAGCTTCTCATTTTGTTCTTGG + Intergenic
1124873549 15:33567808-33567830 CCAGCAACTCATATTGTTATAGG + Intronic
1131012392 15:89029508-89029530 CCAGCTTCATATATTGTATTAGG - Intergenic
1131330357 15:91492775-91492797 CAAGATTTTTATTTTGTTTTTGG - Intergenic
1131765962 15:95676340-95676362 CTAGTTTCTCATATTTCTTTAGG + Intergenic
1131842364 15:96450958-96450980 CAAACATCTCATATTCATTTAGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1202979022 15_KI270727v1_random:331564-331586 CACACTTTTCATATTCTTTTTGG + Intergenic
1202980994 15_KI270727v1_random:359174-359196 TGAGCTTCTCATTTTGTTCTTGG + Intergenic
1138814373 16:60187332-60187354 CAAGCTATTCTTATTTTTTTTGG - Intergenic
1140575200 16:76159506-76159528 TATGCTTCTCAAAGTGTTTTTGG - Intergenic
1149476828 17:56968400-56968422 CAAACTTCTAATCTTGTGTTAGG + Intergenic
1150413095 17:64963362-64963384 CCAGCCTCTCTTATTGTTTCTGG + Intergenic
1150781511 17:68126705-68126727 GAAGCTTCTCACATCGTTGTTGG + Intergenic
1151374632 17:73678350-73678372 CAAGGTTCATATATTGCTTTTGG - Intergenic
1152451664 17:80385324-80385346 AAAGCTTCTAATATGTTTTTGGG - Intronic
1153395266 18:4612905-4612927 CAACCTTCTCAAATTTTGTTTGG + Intergenic
1153453147 18:5251851-5251873 CAAGCTTCATATATTTTCTTGGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155350204 18:24898805-24898827 CATGCTTCTCCTCTTGCTTTTGG + Intergenic
1156210017 18:34929279-34929301 TAAGCTTTTCATACTGTTATTGG - Intergenic
1163119263 19:15206853-15206875 CTGGCTTCTCATCATGTTTTTGG + Intergenic
1163891352 19:20018388-20018410 CCAGCCTCTCAAATTCTTTTAGG + Intronic
1164464089 19:28472857-28472879 CCTGCTTCTCATCTTGTGTTTGG - Intergenic
1167806807 19:51792621-51792643 CAAGTTGCTCATATTGGCTTAGG - Intronic
927297236 2:21468690-21468712 CAAGCTTCTCATAGGGCATTAGG + Intergenic
929078739 2:38100724-38100746 CAATCTGCTTATCTTGTTTTTGG + Intronic
929264072 2:39899039-39899061 CAAGCTTCTCATCATGGCTTTGG + Intergenic
931334890 2:61329526-61329548 CAAGCTTATCAAATTATTTCTGG - Intronic
931718549 2:65049053-65049075 CAAGTTTCCTGTATTGTTTTTGG + Intergenic
931735950 2:65194153-65194175 AAAGCTTCTCATTGTCTTTTAGG - Intergenic
931831611 2:66058064-66058086 CAAGGTTCTCAAATTGCATTTGG + Intergenic
931943173 2:67275701-67275723 GAAGCTTCTCATAACATTTTGGG + Intergenic
937432076 2:121847294-121847316 CATGCTTATCATTTTTTTTTGGG + Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
940120762 2:150262285-150262307 CAAGATTTTCTAATTGTTTTTGG - Intergenic
940852924 2:158705182-158705204 CAAGTTCCTCATATTTTTTGTGG + Intergenic
941133165 2:161679854-161679876 CAACTTTTTCATATTGTTTTGGG + Intronic
942435825 2:175975116-175975138 TAAGCTTCTGATACTGTTTTTGG - Intronic
946324485 2:218977762-218977784 GAAACATCTCATATTGTTGTTGG + Intergenic
946905883 2:224415588-224415610 CAAGGTCCACATATTGTGTTTGG - Intergenic
1169258266 20:4115621-4115643 TAAGGTTCACATATTGTATTTGG + Intergenic
1170521730 20:17193186-17193208 CAATTTTCTCATATTCTGTTGGG + Intergenic
1171022386 20:21597817-21597839 TAAGCTTCTCATTTCCTTTTGGG + Intergenic
1171078706 20:22155899-22155921 CAAGAGCCTCATATTGTTTCAGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1176979292 21:15361304-15361326 CTAGTTTCTCACATTCTTTTTGG - Intergenic
1177013856 21:15759818-15759840 GAAGCTTCAGATTTTGTTTTTGG + Intronic
1178233498 21:30814551-30814573 CAAGTGTCTCATCTTGTTCTTGG - Intergenic
1178369459 21:32015273-32015295 AAAGCTGATCAGATTGTTTTAGG - Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1185372279 22:50466482-50466504 CAAGCTTCTCTTCTTCCTTTAGG - Exonic
951011027 3:17679960-17679982 GAAGTTTCACATATTGGTTTGGG - Intronic
954937467 3:54339685-54339707 CGAGTTTCTAATATTGTTGTAGG - Intronic
956067331 3:65411150-65411172 CTAGTTTCTCATATGGTTCTAGG + Intronic
956269495 3:67435205-67435227 CAACCTTGTAATATTGATTTAGG + Intronic
956275727 3:67499182-67499204 CCATCTTCTCATATAGTTTTTGG + Intronic
957375921 3:79357164-79357186 CATGCTTCTAATAATTTTTTAGG - Intronic
957748953 3:84386779-84386801 CAAGCTTGCTATAGTGTTTTAGG + Intergenic
957817150 3:85315386-85315408 AAAGTTTAGCATATTGTTTTGGG + Intronic
957996844 3:87701043-87701065 CCACTTTCTCATATTGTTTTTGG + Intergenic
958534366 3:95379168-95379190 GAAACTTCTCATATTTTTGTGGG - Intergenic
963398576 3:144766459-144766481 CAATATTCTCATCTTATTTTGGG + Intergenic
963584911 3:147175044-147175066 CCTGATTCTCATCTTGTTTTAGG - Intergenic
964926884 3:161969693-161969715 CAAGCTCCACAGATTATTTTGGG - Intergenic
965003172 3:162984590-162984612 CAAGATTATCCTGTTGTTTTTGG - Intergenic
966092459 3:176156813-176156835 CAAATTTCTCATTTTGTTATGGG + Intergenic
966247030 3:177820287-177820309 TAATCTTCTAAAATTGTTTTAGG - Intergenic
969984934 4:11198724-11198746 CTAGATTCTTATAGTGTTTTGGG - Intergenic
970245906 4:14062967-14062989 TAAGCTACTTGTATTGTTTTAGG + Intergenic
970299857 4:14669793-14669815 CATGATTCTGACATTGTTTTAGG - Intergenic
972890123 4:43547986-43548008 GAAGCTTCTCATTTAGTTGTGGG + Intergenic
973167294 4:47093456-47093478 CAAGCTTATGGTTTTGTTTTGGG - Intronic
974572048 4:63665357-63665379 TAAACTTTTCATATTTTTTTTGG + Intergenic
978245601 4:106568838-106568860 CAAGCTGCTCTTAGTGATTTGGG - Intergenic
978607550 4:110498262-110498284 CAAGGATCTCAGCTTGTTTTTGG + Intronic
979243702 4:118473890-118473912 CAGGCTTCTAAGATTGTTCTGGG + Intergenic
980923369 4:139110275-139110297 TAAGCCCATCATATTGTTTTGGG - Intronic
981257589 4:142680771-142680793 CAAGCATCTCATTTTGGCTTTGG + Intronic
982271293 4:153591854-153591876 CAAGCTCCTGATTTTCTTTTTGG - Intronic
982896892 4:160941570-160941592 CAAGCTTGGCATAATCTTTTGGG + Intergenic
983064488 4:163193057-163193079 CAGGATTCTCATTTGGTTTTTGG + Intergenic
984654882 4:182307062-182307084 CAAGATTTCCATATTATTTTTGG - Intronic
988203392 5:28099203-28099225 CTAGCCTGCCATATTGTTTTGGG + Intergenic
988328052 5:29796887-29796909 TTACCTTTTCATATTGTTTTAGG + Intergenic
988871098 5:35390984-35391006 CAAGCTGCACATATTTTTCTTGG + Intergenic
989945412 5:50221530-50221552 CAAGTTTCTCAGAATGTTTCTGG + Intergenic
990456804 5:55995779-55995801 CAAGATTCTCATCTTCCTTTGGG - Intergenic
994043079 5:95279917-95279939 AAAGCTACTAACATTGTTTTAGG + Intronic
994451010 5:99943643-99943665 CAAGCGTCACATTTAGTTTTTGG + Intergenic
996156992 5:120114408-120114430 CATGCTTCTAATATAGTTTGTGG + Intergenic
998258391 5:140608084-140608106 CCAGCCTCTCATTGTGTTTTTGG + Intergenic
998667075 5:144309572-144309594 CAAACTTCTGTTACTGTTTTGGG + Intronic
1000712186 5:164594540-164594562 CAAGCTTCTCTCATTAATTTAGG - Intergenic
1002333141 5:178459087-178459109 CAAGGTTCCCATATTGTGATTGG - Intronic
1004828613 6:19451634-19451656 CAATTTTCTCCTCTTGTTTTGGG + Intergenic
1005764669 6:28999205-28999227 CAAGCCTCTCATTTTTTTATGGG - Intronic
1005916210 6:30353974-30353996 TAAGCTTTACATATTGTTTATGG - Intergenic
1005941890 6:30566732-30566754 TAAGCTTCACATACTTTTTTGGG + Intergenic
1006709362 6:36052515-36052537 AAAGCTTCTGTTATTATTTTTGG - Intronic
1008467036 6:51842605-51842627 CAATCTTCTCCTCCTGTTTTGGG + Intronic
1009431248 6:63569066-63569088 CAATCTTCTCAGATTGGTTGGGG - Intronic
1010388693 6:75311921-75311943 AAATCTTCTCATCTTATTTTGGG + Intronic
1011420795 6:87170155-87170177 CAAGATTATTATATTATTTTAGG + Intronic
1011812934 6:91154114-91154136 CAAGTGTCTCATATAGTATTAGG + Intergenic
1011860615 6:91751290-91751312 TAAGCATCTCCTATTCTTTTTGG + Intergenic
1011904093 6:92339330-92339352 CAAGATTCTCATTTTGATATGGG - Intergenic
1013974565 6:116062153-116062175 CAAGTTTCTCCAATTGTCTTTGG + Intergenic
1014453970 6:121615538-121615560 CAACCATCTCACATTCTTTTTGG + Intergenic
1014762615 6:125374183-125374205 TAAACTTGTAATATTGTTTTGGG + Intergenic
1015196906 6:130533815-130533837 CATTCTTCTCAGAATGTTTTTGG - Intergenic
1015392308 6:132696530-132696552 CAAGATTCTCATTTTGTCTTTGG - Intronic
1015888048 6:137940743-137940765 CTGGCTTCTCATGTTGTCTTAGG - Intergenic
1017455660 6:154598974-154598996 CAAGGCTCTCATATTGTCTTTGG - Intergenic
1017829258 6:158110580-158110602 CAAGATTCTCAGATTCTCTTTGG - Exonic
1019095108 6:169573323-169573345 AAAACTTTTCATATTGTATTGGG - Intronic
1020047105 7:5048549-5048571 CAAGCTTCACAAATCATTTTTGG - Intronic
1020292465 7:6732407-6732429 CAAGCTTCACAAATCATTTTTGG - Intergenic
1021591003 7:22261851-22261873 CAAGTTTCTCTTTTTTTTTTTGG - Intronic
1021603449 7:22387705-22387727 CAAGGTTCTATTATTATTTTTGG - Intergenic
1022350895 7:29565555-29565577 CAAGCTTATGATATTTGTTTTGG - Intronic
1022796038 7:33731988-33732010 CAGTCTTCTCTTCTTGTTTTGGG + Intergenic
1024235024 7:47391384-47391406 CACGCATCTCATATTTTCTTGGG - Intronic
1024770401 7:52715004-52715026 GAACCTTCTCAAATTGTTCTTGG - Intergenic
1026130698 7:67618560-67618582 CAAGTTTCTGATGTGGTTTTAGG - Intergenic
1026425745 7:70291481-70291503 CTAGCTCCTTATTTTGTTTTGGG + Intronic
1026727643 7:72882006-72882028 CAAGCTTCACAAATCATTTTTGG - Intronic
1027116193 7:75483721-75483743 CAAGCTTCACAAATCATTTTTGG + Intronic
1027121445 7:75525137-75525159 CAAGCTTCACAAATCATTTTTGG + Intergenic
1027275632 7:76551977-76551999 CAAGCTTCACAAATCATTTTTGG - Intergenic
1027664566 7:81028885-81028907 CAAATTTCTCATATTCTTTTGGG - Intergenic
1028840287 7:95422211-95422233 AAAGCTGCTCACACTGTTTTAGG + Intronic
1029678031 7:102085084-102085106 GAATTTTCTCATATTGTTTTCGG + Intronic
1029721339 7:102366531-102366553 CAAGCTTCACAAATCATTTTTGG - Intronic
1031425309 7:121598113-121598135 CATGCTATTCAAATTGTTTTAGG - Intergenic
1031575296 7:123408927-123408949 CAAACTCGTCATATTTTTTTTGG - Intergenic
1031708796 7:125018420-125018442 CAATAATCTCAAATTGTTTTAGG - Intergenic
1031775128 7:125899394-125899416 CAAGGTTTTCATCTTTTTTTAGG + Intergenic
1034885249 7:154794047-154794069 CAAGCTGCTCATGCTGTGTTTGG + Intronic
1035107270 7:156452316-156452338 CAAGGTGCTTATATTGTATTGGG - Intergenic
1035845182 8:2856395-2856417 CAAGCTTTTAATAATATTTTTGG - Intergenic
1037575894 8:20202149-20202171 CAGGCTTGTGAAATTGTTTTGGG + Intronic
1037876206 8:22549913-22549935 CAAGCTTCTCTTATTCTCTAGGG - Intronic
1039649703 8:39328431-39328453 CAAGATTCTCATTTGGCTTTTGG + Intergenic
1040017621 8:42712562-42712584 CAAGCTTATTATTTTCTTTTGGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041138362 8:54786388-54786410 CAAGATTCTCTGCTTGTTTTTGG + Intergenic
1051379695 9:16443265-16443287 CAAACCTCTGATTTTGTTTTAGG - Intronic
1051547851 9:18296271-18296293 CAAGTTTCACATATTATATTTGG - Intergenic
1051621172 9:19050538-19050560 CCAGCTTCTCAAAGTGTTTCCGG - Exonic
1052107696 9:24539619-24539641 TTAGCTTCTCATGTTATTTTAGG + Intergenic
1056235857 9:84593398-84593420 GAAGCTTCTCCTTTTGTTTCTGG + Intergenic
1058741126 9:107943880-107943902 GAAGGTTGTCATATTGATTTAGG + Intergenic
1059030264 9:110685856-110685878 CATGCTTTTCAAATTTTTTTCGG + Intronic
1059531722 9:115041405-115041427 TAAGCTTCCCATATTGTTTGTGG - Intronic
1061280546 9:129595680-129595702 CAAGCTTCTCATATAGCCTGAGG + Intergenic
1062724634 9:138064904-138064926 CCAGCTTCTCAGAGCGTTTTGGG - Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186990650 X:15063555-15063577 CAAGCTTCTCATTTTAGCTTAGG + Intergenic
1187647980 X:21369966-21369988 CAAGTTTTACATATTGTTCTCGG + Intergenic
1193405676 X:81098259-81098281 GAGGTTTCTCATATTGTTGTAGG - Intergenic
1193698886 X:84740358-84740380 CAAGATTTTCATCTGGTTTTGGG - Intergenic
1195041616 X:101019966-101019988 CAAGGTTCTCATCTTGGTATAGG - Intronic
1197022472 X:121708113-121708135 CAAGATAATCATATGGTTTTAGG + Intergenic
1198911860 X:141624001-141624023 CAAGCTTCTCATATTGTTTTTGG - Intronic
1200425400 Y:3014979-3015001 GACGTTTCTCAGATTGTTTTTGG - Intergenic
1201603802 Y:15762973-15762995 AAAGCTCATCATATTGATTTGGG - Intergenic
1201866770 Y:18664306-18664328 CATGTTTCTCTTGTTGTTTTGGG - Intergenic