ID: 1198912875

View in Genome Browser
Species Human (GRCh38)
Location X:141633906-141633928
Sequence CTGTGAAAACAGCTGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 913
Summary {0: 1, 1: 12, 2: 54, 3: 161, 4: 685}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198912868_1198912875 15 Left 1198912868 X:141633868-141633890 CCGTGCACCTAAAAAAGCTGCAG 0: 4
1: 23
2: 235
3: 438
4: 1034
Right 1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG 0: 1
1: 12
2: 54
3: 161
4: 685
1198912869_1198912875 8 Left 1198912869 X:141633875-141633897 CCTAAAAAAGCTGCAGACACTCA 0: 2
1: 88
2: 704
3: 1065
4: 1972
Right 1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG 0: 1
1: 12
2: 54
3: 161
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198912875 Original CRISPR CTGTGAAAACAGCTGGGAGA GGG Intronic
900908540 1:5577749-5577771 CTGTGAAAGTAGCTGGGTGGGGG - Intergenic
902365722 1:15972688-15972710 CTGTGAGATCATCTGGGAGCAGG - Intronic
902752538 1:18527278-18527300 AGGGGAAATCAGCTGGGAGAGGG - Intergenic
902786752 1:18737418-18737440 TTGTGAACACAGCTGGGAGGTGG - Intronic
903127973 1:21260640-21260662 CTGTGAACCCAACTGGCAGAGGG - Intronic
903457091 1:23495163-23495185 ATGAGAAAGCAGCTCGGAGAGGG - Intergenic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
903829257 1:26164824-26164846 CTGGGAAAGCAGGTGGGAGCGGG + Intergenic
904073663 1:27823068-27823090 CTATGCAGACAGGTGGGAGAGGG - Exonic
905358999 1:37405360-37405382 CAGAGAAAAAGGCTGGGAGAGGG + Intergenic
905633367 1:39531469-39531491 CTCTGAAAACACCTGGGACCTGG + Intergenic
908209193 1:61882306-61882328 GTGTGAAAACATTTGGGATATGG + Intronic
908715795 1:67068058-67068080 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
908746785 1:67383955-67383977 CTGTGAAGGCAGTTGGGAGGGGG - Intronic
908871674 1:68620278-68620300 CCATGAAAGCAGCTGGGAGTTGG - Intergenic
908967792 1:69787240-69787262 CCATGAAAGCAGCTGGGAGGGGG - Intronic
909094903 1:71274463-71274485 ATGGGATAAGAGCTGGGAGATGG + Intergenic
909219877 1:72943835-72943857 CAGTGAAAACTGCTGGAATATGG - Intergenic
909229077 1:73062303-73062325 CTGTGAAAGCAGCTGGGAAGGGG + Intergenic
909245007 1:73270091-73270113 TTGTGAAAACAGCTGAGAAGAGG + Intergenic
910323719 1:85979160-85979182 CTATGAAAACCACTGGGATACGG + Intronic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
911305596 1:96228282-96228304 CTGTGAAGACTGTGGGGAGAGGG - Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
911840444 1:102675486-102675508 CCGTGAAAACAGCCGAGAGGGGG - Intergenic
911926215 1:103835634-103835656 CTGTGAAATCATCTGGAAGGGGG + Intergenic
912190976 1:107339989-107340011 CTGTGGCAACAGCAGGGAGGAGG + Intronic
912327769 1:108785010-108785032 CCATGAAAGCAGCTGGGAGAGGG - Intronic
912497658 1:110101896-110101918 CTCTGACATCAGCTGGGAGCAGG - Intergenic
912579088 1:110704298-110704320 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
912703093 1:111893254-111893276 CTGGGCAGACAGCTGAGAGAGGG + Intronic
913018615 1:114764404-114764426 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
913674928 1:121131539-121131561 CTGCTAAAACAGGTAGGAGAGGG + Intergenic
914026769 1:143919171-143919193 CTGCTAAAACAGGTAGGAGAGGG + Intergenic
914523514 1:148439527-148439549 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
914665152 1:149826606-149826628 CTGCTAAAACAGGTAGGAGAGGG + Intergenic
914670613 1:149867215-149867237 CTGCTAAAACAGGTAGGAGAGGG - Intronic
915291693 1:154888415-154888437 CTGGGAAAGCAGCTGGGAATGGG + Intergenic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
915944819 1:160141896-160141918 CTGGGCAGACAGGTGGGAGATGG + Exonic
915977434 1:160400469-160400491 CTGTGGGAACAGCCGGGAGGCGG + Intergenic
916035913 1:160922323-160922345 CTGTGAAAACAGCCAGGAAGTGG + Intergenic
916712854 1:167427321-167427343 ATGTGAAAACACTTGGAAGATGG - Exonic
916791648 1:168130340-168130362 TTGCTGAAACAGCTGGGAGAAGG + Intronic
917245599 1:172997228-172997250 CTGTGAAAACAGCCAGGAGCAGG + Intergenic
917726432 1:177832088-177832110 ATGTAAAAAAAGGTGGGAGAGGG + Intergenic
918752416 1:188289674-188289696 CTGTGAAAGCAGCTGGGAGGAGG - Intergenic
918931383 1:190860252-190860274 CTGTGAAAGCAACTAGGAGAGGG - Intergenic
919247968 1:195013818-195013840 CCATGAAAACAGCTAGGAGGGGG - Intergenic
919409635 1:197227588-197227610 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
920229973 1:204463780-204463802 CTGTGGAAAGAGCTTGGAGCTGG - Intronic
920502957 1:206496975-206496997 CTGTGAGAAGTGCTGGGAAATGG + Intronic
921097023 1:211895469-211895491 CTGTGAAAACAGCAGAGAAGAGG - Intergenic
921480753 1:215662153-215662175 CTGTAAAAACATCTAGGAAAGGG - Intronic
921890906 1:220353005-220353027 CTTTGAAAATAACTGGGAAAAGG - Intergenic
922106437 1:222517230-222517252 CTGTGGAAGCAGCTAGGTGAGGG + Intergenic
922116048 1:222616010-222616032 GTCTGAAGACAGCTGGGACAAGG + Intergenic
922773779 1:228205740-228205762 CTGTGAAAGCCCCTGGGAGGAGG + Intronic
922814834 1:228441206-228441228 CTTTGAAACCAGGAGGGAGAAGG + Intergenic
922927112 1:229358584-229358606 CTATGAAAACCTCTGGGATATGG - Intergenic
923204145 1:231741769-231741791 CTGTGAGAGGAGCTGGGAGCAGG - Intronic
923617439 1:235549396-235549418 ATGTAAAAACAACAGGGAGAAGG + Exonic
924172701 1:241357800-241357822 CTGTGAAAACCGCAGGCAAACGG - Intergenic
924827149 1:247551637-247551659 CTCTGAAATCAGCTGAGAAAAGG + Intronic
1062842762 10:683858-683880 ATTTGAAAGCAGCTGGGAGGAGG + Intronic
1062919764 10:1271034-1271056 CTGTGTGACCAGCTGGGATATGG + Exonic
1062994109 10:1848912-1848934 CTGTGACAACAGCCTTGAGAGGG + Intergenic
1063757055 10:9024004-9024026 CTGTGAAACCAGCTAGAAAATGG + Intergenic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1066098760 10:32098284-32098306 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1066468290 10:35672245-35672267 CTGTGGAAGTAGCTGGGAGGAGG + Intergenic
1066727742 10:38410116-38410138 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1067572736 10:47383872-47383894 CTGAAAAAACAGGGGGGAGAGGG + Intronic
1068299060 10:55114796-55114818 CTTTTAAAATAGCTTGGAGATGG - Intronic
1068431231 10:56934882-56934904 CTATGAAAGCAGCCAGGAGAGGG + Intergenic
1069210291 10:65749579-65749601 TTGAGAAGACAGCTGGGGGAGGG + Intergenic
1069628744 10:69884233-69884255 CACTGAAAGCAGCTGGGAGGAGG - Intronic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1070456186 10:76619746-76619768 CTGTGAAAACATCCAGGAGGGGG - Intergenic
1071035423 10:81238842-81238864 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1071243784 10:83740679-83740701 CTGTGAAAGCAGTTGAGAGGGGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071738280 10:88326798-88326820 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1072035733 10:91561436-91561458 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1072195083 10:93110676-93110698 TTGTGAATACACCTGGGAGTGGG + Intergenic
1072808254 10:98439341-98439363 CTGTGAAAACAGCTGGGAAGAGG + Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073204083 10:101759549-101759571 AAGTGGAAGCAGCTGGGAGAGGG + Intergenic
1073454444 10:103628169-103628191 CTGTGAAAACAACGGAGAGGAGG + Intronic
1073628036 10:105119546-105119568 CTGTGAAAACAGTTGGAACGGGG + Intronic
1074897607 10:117790899-117790921 CTCTCAGAAGAGCTGGGAGAGGG + Intergenic
1076140132 10:128071686-128071708 ATCTGGAAACAGCTGGGAGCAGG + Intronic
1076301133 10:129427184-129427206 ATGTGAAAACAGCTGAGAACTGG - Intergenic
1076356931 10:129860165-129860187 TTCTGAAAACAGCTTGGAGTGGG - Intronic
1076364418 10:129912634-129912656 CTGTGAAATCAGTTGGGAACAGG - Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1078129453 11:8601387-8601409 CTGTGAGAAGAGCTGAGTGAGGG + Intergenic
1078430146 11:11281989-11282011 CTGGGAACACATCTGGGATATGG + Intronic
1078516100 11:12023687-12023709 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1079445830 11:20555515-20555537 CTGTGAAAGCAGCTGGGAATGGG - Intergenic
1079511543 11:21216482-21216504 TCATGAAAGCAGCTGGGAGAGGG + Intronic
1080088566 11:28316169-28316191 CTGTGAAAGCAGCCAGGAGCAGG + Intronic
1080958580 11:37130659-37130681 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
1081009521 11:37791542-37791564 CTATCAAAACATCTGGGACATGG - Intergenic
1081033900 11:38117658-38117680 CTCTGAAAGCAGCTGGGAGGGGG + Intergenic
1081246296 11:40770903-40770925 GCATGAAAACAGCTGGGAGGGGG - Intronic
1081249644 11:40813982-40814004 CTGTGAAAGCAGCCAGGAGAAGG - Intronic
1081708737 11:45203172-45203194 CTGGGAGAACTCCTGGGAGATGG - Intronic
1083793185 11:64999163-64999185 CTGAGGAGGCAGCTGGGAGAGGG + Intergenic
1084694752 11:70746622-70746644 CCCTGAAAGCAGCGGGGAGATGG - Intronic
1084996811 11:72988228-72988250 CTCTGAAGACATCTGTGAGAAGG - Intronic
1085054616 11:73396261-73396283 CATTAAAAACAGCTGGGGGAGGG - Exonic
1085564121 11:77497497-77497519 CTGTGAAAGCAGTTGGTAAAAGG - Intergenic
1085861869 11:80244527-80244549 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
1086334022 11:85781871-85781893 CTGTGAAAGCAGTTGGGAGGGGG - Intronic
1086509646 11:87542990-87543012 CTGTGAAAGCAGCTAGGAAGTGG - Intergenic
1086669331 11:89527974-89527996 CTGTGAAAGCATCTGGGAGAGGG + Intergenic
1087255161 11:95945179-95945201 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
1087447031 11:98268569-98268591 CCATGAAAACAGCTGGGAGCGGG - Intergenic
1087561874 11:99800831-99800853 TTTTGAAGACAGCTGGCAGATGG + Intronic
1087578837 11:100025581-100025603 CCATGAAAACAACTGGGAGGGGG + Intronic
1087877523 11:103375488-103375510 CTGTGAAAGCAGCCAGGAGAGGG + Intronic
1087908562 11:103726971-103726993 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1088143641 11:106649046-106649068 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1088830648 11:113533452-113533474 CTTGGAAAACACCTTGGAGATGG + Intergenic
1089064787 11:115654239-115654261 CTAGGAGAACAGCTGGGACAGGG + Intergenic
1089222720 11:116888240-116888262 CTATGACAACAGCTGAGAAAAGG + Intronic
1090316678 11:125797343-125797365 TTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1090833666 11:130438311-130438333 CTGGGAAAACAGCAGGGAAGAGG + Intergenic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1093038003 12:14351508-14351530 TTATGAAAGCAGCTGGGAGGGGG - Intergenic
1093083952 12:14845733-14845755 CAGTGAAAACAACTGGGGTAGGG + Intronic
1093967213 12:25340425-25340447 CTGTGAAAGCAGCCTGGAAAGGG - Intergenic
1094208504 12:27866052-27866074 CTCTGAAACCAACCGGGAGATGG + Intergenic
1094282427 12:28754726-28754748 CTGTGAAAGCATCTGGGAGGGGG - Intergenic
1095382865 12:41615872-41615894 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1095640837 12:44483329-44483351 CTGTGAAAACAGCCAGGAGGGGG - Intergenic
1095919681 12:47516824-47516846 CTGTGAAAGCAGCCAGGAGTGGG - Intergenic
1096549116 12:52360634-52360656 CTCTGAAAACAGCTGCCAGGAGG + Exonic
1096969211 12:55651955-55651977 CCATTAAAACAGCTGGGAGGGGG + Intergenic
1097194059 12:57234164-57234186 CAGTGAGATCAGCTGGGGGAGGG - Intronic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1097445687 12:59668300-59668322 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1097580738 12:61453784-61453806 CTGTGAAAGCAGCCAGGAGCAGG + Intergenic
1098144910 12:67488311-67488333 CCATGAAAGCAGCTGGGAGTGGG - Intergenic
1098462064 12:70742779-70742801 CGGGGGAAACAGTTGGGAGAAGG + Intronic
1098761904 12:74435211-74435233 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
1099352937 12:81595006-81595028 GTTTGAAAACAGCTGAGTGAAGG + Intronic
1099607970 12:84829124-84829146 TTGTGAAAGCATCTAGGAGAGGG + Intergenic
1099618539 12:84972043-84972065 GTCTGAAAACAACTGGGATAAGG + Intergenic
1099778600 12:87165722-87165744 CCATGAAAGCAGCTGGGAGGTGG - Intergenic
1099911400 12:88838678-88838700 CTGTGAAAGCAGCTGAGAGGGGG - Intergenic
1100123468 12:91395496-91395518 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100348278 12:93753791-93753813 CAGTGAAAGCAGCTGGGAGGGGG - Intronic
1100929073 12:99585404-99585426 CTGTGAAAGTAGCCGGGAGGGGG - Intronic
1101194597 12:102369627-102369649 CTGTGAAGGCAGCAGGGAGGGGG - Intergenic
1101682767 12:106985660-106985682 CAGTGAAGGCAGCTGGGTGAAGG - Exonic
1101692811 12:107097141-107097163 CTGTGAAGGAAGCTGGGAGGGGG + Intergenic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102506800 12:113389018-113389040 GTGGGAATGCAGCTGGGAGAAGG - Exonic
1103264638 12:119618480-119618502 CTGTGAAAGCAGCTAGGGAAGGG + Intronic
1103994654 12:124821312-124821334 CTGAGAAACCAGGTGGGAGAGGG - Intronic
1104833973 12:131775096-131775118 GTGTTAAAACAGAGGGGAGATGG - Intronic
1105639251 13:22245288-22245310 CTTTGACAAGGGCTGGGAGATGG - Intergenic
1105757359 13:23480221-23480243 CTCTTAAAACAGATAGGAGAAGG + Intergenic
1105805591 13:23950152-23950174 CTCTGAAAACACTTGGCAGAAGG + Intergenic
1106734850 13:32578314-32578336 CTGTGAAAGCAGCCTGGAGGGGG + Intergenic
1106864483 13:33948611-33948633 CTGTGAATTCAGCCAGGAGAGGG + Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107006836 13:35621338-35621360 CTATAAAGACATCTGGGAGAAGG - Intronic
1107205951 13:37788604-37788626 CTGTGGAAACCACTGAGAGAAGG - Intronic
1107514548 13:41116232-41116254 GTGTGAAGACAGCGGGGATAGGG + Intergenic
1108575432 13:51786375-51786397 GAGTGAAGACAGATGGGAGAGGG - Intronic
1108716435 13:53083456-53083478 CGAGGAAAACAGTTGGGAGATGG + Intergenic
1108716490 13:53084060-53084082 CTGTAAAAAAAGGGGGGAGAGGG - Intergenic
1109171971 13:59107921-59107943 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1109334153 13:60971387-60971409 CCATGAAAGCAGCTGGGAGAGGG + Intergenic
1109391858 13:61704571-61704593 CTGTGAAAGCAGCTAGGATTGGG + Intergenic
1109475620 13:62876974-62876996 CTGTGAAAGCAGCCGGGAAGGGG - Intergenic
1109697397 13:65978162-65978184 CTGTGAAAGCAGTCAGGAGAGGG + Intergenic
1109749636 13:66672638-66672660 CTGTGAAAGCAGTTGGGAGGGGG + Intronic
1109905243 13:68831287-68831309 CTGTGAAAACAGCCAGGAGTGGG + Intergenic
1110038469 13:70718480-70718502 CTGTGAAAGCAGCAAGGAGGGGG + Intergenic
1110208586 13:72946863-72946885 CCATGAAAGCAGCTGGGAGCAGG - Intronic
1110341902 13:74402272-74402294 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1110566184 13:76959652-76959674 CTGTGAAGGAAGCTGGGAGGAGG - Intergenic
1110929170 13:81194123-81194145 CAGTGAAAGCAGCTGGGAGGGGG - Intergenic
1110955294 13:81546279-81546301 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1111105686 13:83642630-83642652 CTGTGAAAGCAGCCCGGAGGAGG - Intergenic
1111154984 13:84310063-84310085 CTGTGAAAACAGCCAGGAGGGGG + Intergenic
1111263683 13:85778145-85778167 CTGTAAAAACAGTTGAGTGAGGG + Intergenic
1111313196 13:86517024-86517046 CTGTGATAACAGCTAGTAGGGGG - Intergenic
1111339315 13:86862871-86862893 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1111358823 13:87146582-87146604 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1112031304 13:95459164-95459186 CTGTGAAAGCAGCCAGGAGTGGG - Intronic
1112682632 13:101784658-101784680 ATGGGAAAATAGCTGGGAAATGG - Intronic
1112749535 13:102567954-102567976 CTGTGGAAGAAGCTGGGAGAGGG - Intergenic
1112825003 13:103382086-103382108 CTGTGAAAGGAGCTGGGAGGGGG - Intergenic
1112826543 13:103398474-103398496 CTGTGAAAGCAGCTGGGATCGGG - Intergenic
1112995982 13:105575558-105575580 CTATGAAAGCAGCGGGGAGGGGG + Intergenic
1113029339 13:105976435-105976457 CTGTGAAAGCAGCCAGGAGAGGG - Intergenic
1114680435 14:24479672-24479694 CTGTGAAAGCAGCTAGAAGTTGG - Intergenic
1115007099 14:28498971-28498993 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115134847 14:30095947-30095969 CAGTGAAAGCAGCTGGGAAAGGG + Intronic
1115505446 14:34089521-34089543 CAGTGAAAACTTCTGGGAGATGG - Intronic
1115609006 14:35034206-35034228 CTGTGAAAGCAGCCGGGAGGGGG - Intergenic
1116098853 14:40408134-40408156 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1116542302 14:46113100-46113122 CTGTGAAAAAAGCCAGGAGAGGG + Intergenic
1118519181 14:66562015-66562037 CTTTGAAAACAATTGGGAAAGGG + Intronic
1118598066 14:67451419-67451441 CTGTGAAAGCAGCCAGGAGAAGG + Intronic
1119126149 14:72129131-72129153 CTGAGAAAACTGCGTGGAGAAGG + Intronic
1119428907 14:74552958-74552980 CTGTGCCAACAGCTGTGAGAGGG - Exonic
1120257841 14:82142127-82142149 CTGTGAAAGCAGCTTGGAGTTGG - Intergenic
1120408799 14:84124022-84124044 CTGTGTCAAGAGCTGGGAGTGGG - Intergenic
1120443350 14:84564680-84564702 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1120469433 14:84903735-84903757 CAGTGAAAGCAGCTAGGAGTGGG + Intergenic
1120591003 14:86373067-86373089 CTGTGAAAGCAGCTTGGAGAGGG + Intergenic
1120658984 14:87230460-87230482 CTGTGAAGGCAGCTGGGATGGGG - Intergenic
1120817993 14:88883346-88883368 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1121063399 14:90938316-90938338 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
1121471220 14:94155873-94155895 CTGTGAAAGCAGCTTGGAGTGGG + Intronic
1121636688 14:95458510-95458532 GTGTGAGAAGAGCTTGGAGAAGG - Intronic
1121999212 14:98632705-98632727 CTGTGCAAAGAGCTAGGAGCTGG + Intergenic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1123038573 14:105481266-105481288 CTGTGCCAACGGCTGGGAGCAGG - Intergenic
1123140076 14:106067692-106067714 ATATGAAAACAGGTGGGAGCAGG - Intergenic
1123696804 15:22884558-22884580 CTGTGAAAACAGCCAGGAGGGGG - Intronic
1124001152 15:25761507-25761529 CTGTGAAAGCAGCCAGGAGTGGG + Intronic
1124556030 15:30726829-30726851 CTGTGAAAGCAGCCAGGAGTGGG - Intronic
1124664557 15:31581262-31581284 CTGTGAAAGCAACTAGGAGGAGG - Intronic
1124675244 15:31678942-31678964 CTGTGAAAGCAGCCAGGAGCGGG + Intronic
1125304171 15:38291307-38291329 CTGTGAAAGCAGCCAGGAGGAGG - Intronic
1125539498 15:40461845-40461867 CTCTGAAAGCAGATGGGTGATGG + Intronic
1125814967 15:42576065-42576087 CTTTGAGAAAGGCTGGGAGAGGG + Intronic
1126064951 15:44819509-44819531 CGATGGAAACAGCTGGGAGCTGG + Intergenic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1126825020 15:52540163-52540185 CTGTGAAAGCAGCTGAGAAAAGG - Intergenic
1126869918 15:52976792-52976814 CTGTGAAAGCAGCGGGGTGGGGG - Intergenic
1126942031 15:53778329-53778351 CCGTGAAAGCAGCTGGGAGGGGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1129628972 15:77236249-77236271 CTGTGAAAGCAGCTGGGACGGGG + Intronic
1130421983 15:83757016-83757038 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1130439207 15:83934158-83934180 CCATGAAAGCAGCTGGGAGGGGG + Intronic
1130442843 15:83972936-83972958 GTGTGAAGACAGCAGGGAAACGG - Intronic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1131659572 15:94499205-94499227 CTGTGAAAGCAGCCAGGAGGTGG + Intergenic
1132272431 15:100538178-100538200 CTGTGAAAACAGCTGGGAGCAGG - Intronic
1132408216 15:101557727-101557749 CTGTGATTACAGGTGGGAGGAGG - Intergenic
1132811259 16:1798947-1798969 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1132899301 16:2244589-2244611 CTGTGATGCCAGCTGGGAGGTGG - Intronic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133459554 16:5975535-5975557 CTGTGAAAACAGCTTATAAAGGG - Intergenic
1133540375 16:6746890-6746912 CTGAGAAGACTGCTAGGAGATGG - Intronic
1134658126 16:15963278-15963300 CTGTGAAAGCAGCCAGGAGCGGG - Intronic
1134863425 16:17582469-17582491 CTGTGAACACAGTGGGGAAAAGG + Intergenic
1136642426 16:31578075-31578097 CTGTGAAAGCAGCAAGGAGTGGG + Intergenic
1136684553 16:31986574-31986596 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1136785179 16:32930117-32930139 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1136884603 16:33923687-33923709 CTGGGAAAACAGCCCAGAGAGGG - Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1137929182 16:52570464-52570486 CAGTGAAAACATCTTGGAAAAGG - Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1139265410 16:65634170-65634192 CTCTGAACACAGCAGGCAGATGG + Intergenic
1140906967 16:79417435-79417457 CTTGGAAACCGGCTGGGAGAGGG - Intergenic
1141306044 16:82865138-82865160 CTGTGAAAGCAGCTGGGAGTGGG - Intronic
1141457926 16:84156585-84156607 CTGCTAAAATAACTGGGAGAAGG - Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141576697 16:84968563-84968585 CGGTGGAAGCATCTGGGAGATGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1203087839 16_KI270728v1_random:1194126-1194148 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1143172410 17:4937947-4937969 GTGTGAAGGCAGCTGGGTGAGGG - Intronic
1143740128 17:8946414-8946436 CTATGAAAACTACTAGGAGATGG + Intronic
1144281815 17:13734039-13734061 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
1146360245 17:32169107-32169129 GAGTGAAAACAGCTTAGAGAGGG - Intronic
1146526509 17:33571522-33571544 CAGTGACAGGAGCTGGGAGAGGG - Intronic
1146839614 17:36141488-36141510 CTTTGACCACGGCTGGGAGATGG - Intergenic
1147145485 17:38482255-38482277 CTGGGAAAACAGCCCAGAGAGGG + Intronic
1147348817 17:39824064-39824086 CCGTGAAAGCAGCTGGGAAGGGG + Intronic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1147834359 17:43319496-43319518 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1148071377 17:44910778-44910800 CTGGGGAAAAAGCTAGGAGATGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148326024 17:46783959-46783981 CTGGGAAAGCGGCTGGGAGGCGG + Intronic
1149029555 17:52067651-52067673 CTGTGAAAGCAGCTGGGAGGTGG + Intronic
1149072253 17:52556787-52556809 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1149116097 17:53098006-53098028 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1149190005 17:54050136-54050158 CTGTGAAAGCAGCCAGGAGGTGG - Intergenic
1149896565 17:60433006-60433028 CTGTGAAAGCAGCCAGGAGTGGG - Intergenic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150450353 17:65261411-65261433 CACTGACAGCAGCTGGGAGACGG + Intergenic
1151135885 17:71945384-71945406 CCGTGAAAGCAGCCGGGAGGGGG + Intergenic
1151436254 17:74099634-74099656 CAGAGATCACAGCTGGGAGATGG + Intergenic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1152035354 17:77868939-77868961 AAGAGAAAAGAGCTGGGAGAAGG + Intergenic
1152243722 17:79174149-79174171 GGGTGAAAACACCTGGTAGAAGG + Intronic
1153115668 18:1652616-1652638 CTGTGAGGGGAGCTGGGAGAAGG + Intergenic
1153577229 18:6534648-6534670 CTCTGAAAACTCATGGGAGAGGG - Intronic
1155049772 18:22136513-22136535 ATGAGAAAACAGCTGGAAGGAGG + Intergenic
1155815868 18:30308873-30308895 CTTTGACAAGAGCTGAGAGATGG + Intergenic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1156151548 18:34249643-34249665 CTATGAAAGCAGCTGGGAGTGGG - Intergenic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1157129884 18:44996907-44996929 CTGTGCAAAAAGCAGTGAGATGG + Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158791456 18:60784855-60784877 CTGTGAAAACAGCTAGGAGGGGG + Intergenic
1159184019 18:64946610-64946632 CTTTAAAAAGAGCTGGTAGAGGG - Intergenic
1159461145 18:68723729-68723751 CTGTGAAAGCAGCCAGGAGTGGG - Intronic
1159697290 18:71575725-71575747 CTGTGAAGGCAGCTGGGAGGGGG - Intergenic
1159718749 18:71858877-71858899 CTGTGAAAGCAGCCAGGAGTTGG - Intergenic
1159767631 18:72509536-72509558 CTGTGAAAGCAGCTGGGATGGGG - Intergenic
1159839043 18:73374549-73374571 CTATGAAAACCTCTGGGATATGG + Intergenic
1162593167 19:11606466-11606488 CTGTGAAAGCAGCCAGGAGTGGG - Intronic
1164018139 19:21270995-21271017 CTATCAAAACATCTGGGATATGG - Intronic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1164629801 19:29754768-29754790 CTGTGAGCACAGTGGGGAGAGGG - Intergenic
1164674118 19:30090587-30090609 CTGGGGAAACCGGTGGGAGAGGG + Intergenic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166434700 19:42757715-42757737 CAGTGAACACAGCTGGGATTTGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167403534 19:49288893-49288915 CCGTGAAAGCAGCTGGAAGGGGG + Intergenic
1168326623 19:55541865-55541887 CTGGGAGACCAGCTGGGAGTTGG - Intronic
925493105 2:4417865-4417887 CTTTTAAAATAGCTGAGAGAAGG - Intergenic
925724506 2:6859917-6859939 CTGTGAAAGCAGCAAGGAGGGGG + Intronic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926368943 2:12161377-12161399 GTTTGAGAGCAGCTGGGAGATGG - Intergenic
926378455 2:12259711-12259733 CTGTGAAATCACCAGGGAGTTGG + Intergenic
926526831 2:13991847-13991869 CTATGAAAGCAGCTGGGGGTCGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
926734570 2:16063150-16063172 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
926919443 2:17926249-17926271 CCATGAAAGCAGCTGGGAGGAGG - Intronic
927341855 2:21992079-21992101 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
928625437 2:33134866-33134888 CTGTCAGAACAGCTGTGAGAAGG + Exonic
928821487 2:35366750-35366772 CTGTGAAAACAGCCAGGAGGGGG + Intergenic
929033560 2:37671307-37671329 CTGGGAAACCAGCAGGGAGTCGG - Intronic
929689129 2:44060026-44060048 CTGTGAAAGCAGCCAGGAGCGGG - Intergenic
929824340 2:45298687-45298709 CTGTGAGAGCAGCTGTGAGAGGG + Intergenic
929955076 2:46451704-46451726 CTGAGAAGAAAGTTGGGAGAGGG + Intronic
930427796 2:51233925-51233947 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
930514825 2:52393526-52393548 CCTTGAAAGCAGCTGGGAGGGGG - Intergenic
931367025 2:61627907-61627929 CCATGAAAACAGCTGGGACCAGG + Intergenic
932537666 2:72617205-72617227 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
932795616 2:74692620-74692642 CTTTGCAAACAGCTAGGATAGGG + Intergenic
932842080 2:75092735-75092757 CTGTGAAAGCTCCTGGGAGAGGG + Intronic
932912226 2:75818072-75818094 CTGTGAAAGCAGCCAGGAGCGGG - Intergenic
933085160 2:78046391-78046413 CTGTAAAAGCAGCTGGGAGTGGG + Intergenic
933321740 2:80783872-80783894 CTATGAAAAAAGCTTGCAGAAGG - Intergenic
933363371 2:81316069-81316091 GTGTGAGGACAGCTTGGAGATGG - Intergenic
933508069 2:83204004-83204026 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
933798654 2:85942271-85942293 CTCTGAAAGCAGCCAGGAGAAGG - Intergenic
934862582 2:97776693-97776715 CTCTGACATCTGCTGGGAGATGG + Intronic
935457722 2:103289485-103289507 CTGTGGGAACAGCTTGGAGGTGG - Intergenic
935473132 2:103483614-103483636 TTGAGAAAACAGCTGAAAGAAGG - Intergenic
935562021 2:104569062-104569084 TTCTGAATACAGCAGGGAGAAGG + Intergenic
935625920 2:105172282-105172304 CCATGAAAGCAGCTGGGAGAGGG - Intergenic
935805609 2:106744597-106744619 GTGTGAAGACAACGGGGAGAGGG + Intergenic
935919334 2:107994120-107994142 CTGTTGAGGCAGCTGGGAGATGG + Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936788606 2:116124336-116124358 CTGTGAAAGCAGCCAGGAGCAGG + Intergenic
936794964 2:116194066-116194088 CCATGAAAGCAGCTGGGTGAGGG - Intergenic
936940913 2:117883195-117883217 CTGTGAAAGCAGCTGAGAAGGGG + Intergenic
937031488 2:118744501-118744523 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
937427706 2:121813757-121813779 CTGTGAAAGCAGCCGGGAGGGGG + Intergenic
937548535 2:123056742-123056764 GTGTTAAAACAACGGGGAGATGG - Intergenic
937554095 2:123132627-123132649 CTGTGAAAGCAGCCAGGAAAGGG + Intergenic
937756687 2:125547727-125547749 CTCTGAAAACAGCAGGCAGTGGG - Intergenic
938234652 2:129695952-129695974 CCATGAAAACAGCTGGGACAGGG + Intergenic
939740763 2:145902614-145902636 CCATGAAAGCAGCTAGGAGAAGG + Intergenic
940596127 2:155795470-155795492 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
941031706 2:160519158-160519180 CTGTGGGAAAAGTTGGGAGAGGG - Intergenic
941165444 2:162078667-162078689 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
941513067 2:166437620-166437642 CTGTGAAGGCAGCTGGGATCGGG + Intronic
942380567 2:175386329-175386351 TTGTGAAAACAGCAGGGAGGAGG + Intergenic
942644450 2:178095473-178095495 CTGTGAAAGCAGCCAGGAGCAGG - Intronic
942889063 2:180965073-180965095 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
943001189 2:182330548-182330570 GAGAGAAAACAGCTGAGAGAAGG - Intronic
943278158 2:185895764-185895786 CTCTGTAAACAGGTTGGAGAGGG - Intergenic
943415037 2:187591191-187591213 CTGTGAAAGCAACTGGGAGGAGG - Intergenic
943448623 2:188020298-188020320 CCATGAACATAGCTGGGAGAGGG + Intergenic
943609424 2:190015000-190015022 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
943832942 2:192485542-192485564 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
943936137 2:193919129-193919151 CTGTGAAAGCAGCTTGGAGGGGG + Intergenic
944272157 2:197796111-197796133 CTGTGAAAGCAGCCAGGAGGTGG - Intergenic
944800220 2:203231495-203231517 CCGTGAAAGCAGCTGGGAGGGGG + Intergenic
945073726 2:206016142-206016164 CCATGAAAACAGCCAGGAGAGGG + Intronic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
945362950 2:208913695-208913717 CTGTGAAATGAGTTGGGAGCAGG - Intergenic
945584300 2:211639464-211639486 CTGTGAAGAAAAGTGGGAGAGGG + Intronic
945623466 2:212171046-212171068 CTGTGAAAGCAGCCAGGAGGGGG + Intronic
945756737 2:213856321-213856343 CCATGAAAGCAGCTGGGAGGGGG - Intronic
945931047 2:215854984-215855006 CCATGAAAGCAGCTGGGAGAGGG + Intergenic
946108203 2:217390697-217390719 CTGTGAAAGCAGCCAGGAGCAGG - Intronic
946672276 2:222117873-222117895 CTGTGTAAAGATCTGAGAGAGGG - Intergenic
947872173 2:233445345-233445367 ATGTGATGACAGCTGAGAGATGG + Intronic
948016699 2:234697046-234697068 CGGTGAAAGCAGCCAGGAGAGGG - Intergenic
948737319 2:240017434-240017456 ATGTGTAACCGGCTGGGAGATGG - Intronic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
1169320895 20:4632442-4632464 TTGTGAAAACAGCCAGGAGTAGG + Intergenic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169955312 20:11096427-11096449 ATGTGAAAGCAGCTGGCACATGG + Intergenic
1170037567 20:12005016-12005038 TTGTGAAAGCAGCCAGGAGAAGG + Intergenic
1170156788 20:13276196-13276218 CTGTGGAAACTGGTGGGAGTGGG - Intronic
1171749865 20:29038464-29038486 CTGTGAAAGCAGCCAGGAGGAGG - Intergenic
1171792800 20:29543867-29543889 CTATGAAAACAGCCAGGAGGTGG - Intergenic
1171858278 20:30370415-30370437 CTGTGAAGACAACTGGGGTAAGG + Intergenic
1172606318 20:36216681-36216703 CTGTGAATCCAGCTTGAAGAAGG + Intronic
1172811945 20:37654477-37654499 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1172823616 20:37761036-37761058 CATTGAAAACAGCTATGAGAGGG + Intronic
1172824781 20:37772201-37772223 GTTTGAGAACAGCTGGGAGGAGG - Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175608531 20:60331101-60331123 CTGTGAAGACAGCAAGGAAATGG + Intergenic
1175735141 20:61380533-61380555 GGGTGAAAACAGGTGGGAGGGGG - Intronic
1176877717 21:14149860-14149882 CCATGAAAGCAGCTGGAAGAGGG - Intronic
1176883809 21:14230058-14230080 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1176935316 21:14860534-14860556 CCATGAAAACAGCTGGGAGGAGG - Intergenic
1177284962 21:19037867-19037889 CTCTTACAGCAGCTGGGAGATGG - Intergenic
1177522139 21:22239448-22239470 CTGTGAAAACAGCTGGCAGGGGG + Intergenic
1177529079 21:22337188-22337210 CTGTGAAAGCAGCTGGGATGGGG + Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1177857855 21:26419778-26419800 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1178106095 21:29320912-29320934 CTGAGCAAACAGATGGGAGCAGG - Intronic
1178144017 21:29717396-29717418 CCATGAAAGCAGCTGGGAGGGGG + Intronic
1178261818 21:31106863-31106885 CCTTGAAAGCAGCTGGGAGGTGG - Intergenic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1180004381 21:45013315-45013337 CTGTGCAAACAGCCAGCAGAAGG + Intergenic
1180406607 22:12561361-12561383 CTGTGAAAGCAGCCAGGAGGAGG - Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1182368305 22:29793279-29793301 CTGTGTAAACAAGTGGGTGAGGG + Intronic
1182393974 22:30022097-30022119 CTCTGAAGCCAGCTGGGAGCAGG + Exonic
1182815732 22:33161756-33161778 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1183077752 22:35437460-35437482 CTGAGGAAACAGCTGAGAGATGG + Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
949464355 3:4329114-4329136 CTGTTAAAGCAGCCAGGAGAAGG - Intronic
949623569 3:5844192-5844214 CCATGAAAACAGCCAGGAGAGGG - Intergenic
949630825 3:5924299-5924321 CTGCGAAAACAGCTGCTATATGG + Intergenic
949635918 3:5981420-5981442 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
949973791 3:9435292-9435314 CTGTGAAAAGAGCTGGCTGGGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
950913257 3:16616719-16616741 CTGTGTAAGCAGCCAGGAGAGGG + Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
951969720 3:28430159-28430181 CTGTTAAAGCAACTGGGAGTGGG + Intronic
952401262 3:32966209-32966231 CCGTTAAACCAGCTGGGAGCGGG + Intergenic
952504476 3:33995582-33995604 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
952569869 3:34701573-34701595 CTGTGAAAGCAGCCAGGAGTGGG - Intergenic
954145216 3:48631098-48631120 CTTTGAGAACAGCTGGGTGTTGG + Exonic
954516987 3:51187114-51187136 CTGTGAAAGCAGCCAGGAGAGGG + Intronic
955334560 3:58074391-58074413 CTGAGAAATGAGCTGGGAAATGG + Intronic
956388517 3:68746979-68747001 GTCTCAAGACAGCTGGGAGAGGG - Intronic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957457698 3:80473134-80473156 CTGTGAAAGAAGCTGGGAGGAGG + Intergenic
957857325 3:85895140-85895162 CTATGAATGCAGCTGGGAGGGGG + Intronic
957909550 3:86603959-86603981 CTGTGAAAGCAGCTGAGAGGGGG + Intergenic
957956626 3:87196329-87196351 CTGGGAAAGCAGCTAGGAGGAGG + Intergenic
958531664 3:95340444-95340466 CTGTTAAAACAGCTCTGAGTTGG - Intergenic
958609742 3:96410189-96410211 CTGTGAAAGCAGCTGGGATGGGG - Intergenic
958836286 3:99148582-99148604 CTGTGAAAGCAGCCTGGAGGGGG + Intergenic
959031769 3:101308125-101308147 CTGTGAAGGCAGCTGGGAGGCGG - Intronic
959171983 3:102854861-102854883 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
959229738 3:103632627-103632649 CTGTGAAGGCAGCTGTGAGAGGG + Intergenic
959406918 3:105971712-105971734 CCATGAAAGCAGCTGGGAGGAGG - Intergenic
959606342 3:108245359-108245381 CTATGAAAGCAGCTGGGAGCGGG + Intergenic
959809052 3:110593994-110594016 CTGTGAAAACAGCTGGGAGTAGG + Intergenic
960478265 3:118158048-118158070 CTGTGGAGGCAGCTGGGAGGGGG - Intergenic
960492435 3:118333549-118333571 CTATGAAAGCAGCTGGGAGGGGG + Intergenic
960566648 3:119139759-119139781 CTTTTAAAACAGGTAGGAGAAGG - Intronic
960609347 3:119541100-119541122 CTTAGAAAAAAGGTGGGAGATGG - Intronic
961092146 3:124122712-124122734 ATGAGAAAACAGCTGGTAGGTGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
962636678 3:137338788-137338810 CTATGAAAGCAGCTGGGATGGGG + Intergenic
963107892 3:141661805-141661827 CTGAGAGGACACCTGGGAGATGG + Intergenic
963431383 3:145209281-145209303 CTGTGAATGATGCTGGGAGATGG - Intergenic
963538887 3:146562113-146562135 CTGTGAAAGTAGCTGTGAGGGGG - Intergenic
963581813 3:147135127-147135149 CCATGAAAACAGCCAGGAGAGGG - Intergenic
963671661 3:148258788-148258810 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
964910825 3:161777569-161777591 ACATGAAAACAGCTGGGAGGAGG + Intergenic
965092547 3:164181475-164181497 CTGAGAAGGCAGCTGGGAGGGGG - Intergenic
965270668 3:166613601-166613623 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
965929821 3:174029217-174029239 CTGTGAAAGGAGCTGAGAGGTGG + Intronic
966153650 3:176892681-176892703 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
966722591 3:183079550-183079572 CTGTGAAAGCTGCCAGGAGAGGG - Intronic
966909411 3:184550524-184550546 CTGGGCAAACATCTGGGAGGCGG - Intronic
966974083 3:185069891-185069913 CTGGGAAAGCAGCTGCAAGAGGG - Intergenic
967404578 3:189101144-189101166 CTGTGAAAAGAGTTGGAAGGGGG - Intronic
967748806 3:193089931-193089953 CTTTGCAATCAGCTGGGAGCGGG + Intergenic
969996376 4:11317124-11317146 CTGTGAAAGCAGCCAGGAGTGGG - Intergenic
970057715 4:11994150-11994172 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
970061568 4:12039689-12039711 CTATGAAAGCTGCTGGGAGGGGG + Intergenic
970276411 4:14405750-14405772 CTGTGGAAAGAGCTGGCACATGG + Intergenic
970306054 4:14733815-14733837 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
970655874 4:18229523-18229545 CTGTGAAAACAGCCAGCAGTGGG - Intergenic
970655963 4:18230154-18230176 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
970800390 4:19966228-19966250 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
970835674 4:20403340-20403362 CAGTGAAAACTGCTGGGAATTGG - Intronic
971440503 4:26679700-26679722 CTGTGAAAGCAGCTGTGAGTGGG + Intronic
971710512 4:30105478-30105500 CCGTGAAAGCAGCTGGGAGGGGG - Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971840987 4:31851488-31851510 CTGTGAAAGAAGCTGGGAGTGGG + Intergenic
971962579 4:33507888-33507910 CTATGAAAGCAGATGGGAGGGGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972220564 4:36949943-36949965 CTGTGAACTCAGCTGGGAGGAGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972574592 4:40340021-40340043 CTATCAAAACAGGAGGGAGAGGG - Intronic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
972839512 4:42914253-42914275 CTATGAAAGCAGCTGGGAGGGGG + Intronic
972890785 4:43553841-43553863 CTGTGAAAGCAACCAGGAGAGGG + Intergenic
973101494 4:46277280-46277302 CTCTGACAACAGCAGGGAGGAGG + Intronic
973107817 4:46361723-46361745 CTGTGAAAGCAGCCAGGAGGAGG + Intronic
973110489 4:46390862-46390884 CTGTGAAAAGAGGTTGGAAAAGG - Intronic
973263092 4:48184543-48184565 TTGAGAAAAGAGGTGGGAGAGGG - Intronic
973976476 4:56267961-56267983 ATGAGAAAAAGGCTGGGAGAGGG - Intronic
974071486 4:57127995-57128017 CTGCGAAAACAGCCAGGAGCGGG + Intergenic
974075264 4:57163262-57163284 CCTTGAAAAGAGCTTGGAGAAGG - Intergenic
974101535 4:57422675-57422697 CTGTAAAAGCAGCCAGGAGAGGG + Intergenic
974269563 4:59633165-59633187 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
974317893 4:60306199-60306221 CTGTGAAAACAGCCGGGAGGGGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
974925403 4:68292082-68292104 CTGTGAAAGCAGCAGGGAAGGGG - Intergenic
975040396 4:69739074-69739096 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
975371967 4:73599508-73599530 CTGGGAAAACAGCTGTGGTAAGG + Intronic
975738150 4:77401677-77401699 CTGGGAAAGCAGCTGAGAGTAGG + Intronic
976075851 4:81298328-81298350 CCATGAAAACAGCTGGGAGCAGG + Intergenic
976365701 4:84230278-84230300 CTGTGAAAGCAGCTTGGAGTGGG - Intergenic
976556117 4:86453173-86453195 CTGGGAAAGCTGCAGGGAGAAGG + Intronic
976635716 4:87284819-87284841 CTGTGAAAGCAGCTAGGAGGGGG + Intergenic
976952517 4:90850425-90850447 CTGTGAAACCAGCTGGGAGCTGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977041410 4:92024187-92024209 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
977197458 4:94081091-94081113 CTGTGAAAGCAGCCAGGAGGAGG - Intergenic
978034535 4:103976863-103976885 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
978044936 4:104114367-104114389 CCATGAAAACAGGTGGGAGAGGG - Intergenic
978234878 4:106446513-106446535 CTGTGAAAGCAACTGGGAGGGGG - Intergenic
978363277 4:107953831-107953853 CTGTGGAAAAAGCTGGCAGGGGG - Intergenic
978515605 4:109565482-109565504 CAGTGAAAACATTTGGGTGAAGG + Intronic
978856608 4:113401145-113401167 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
978991294 4:115085006-115085028 CTGTGAAAGCAGATGTGAGGGGG + Intronic
979038432 4:115754845-115754867 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
979233030 4:118368028-118368050 CTGAGAAAAGAGGTAGGAGAGGG + Intergenic
979254726 4:118598409-118598431 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
979334235 4:119447622-119447644 CTGTGGAAGCAGCTAGGTGAGGG + Intergenic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
979764354 4:124446518-124446540 CTGTGAAAGCAGCCGGGAGGTGG - Intergenic
979839793 4:125423721-125423743 CTGTGAAGGCAGCTGGGAGTGGG + Intronic
979966942 4:127086926-127086948 CCATGAAAGCAGCTGGGAGGAGG + Intergenic
980006909 4:127552704-127552726 CCATGAAAGCAGCTGGGAGAGGG + Intergenic
980083551 4:128368951-128368973 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
980163420 4:129195246-129195268 CTGTGAAAACTACTTGGGGATGG - Intergenic
980280037 4:130707222-130707244 CTGTGAAAGCAGCCAGGAGTGGG - Intergenic
980579666 4:134732873-134732895 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
980596578 4:134962647-134962669 CTGTGAAAGCAGCCCGGAGGGGG + Intergenic
980633223 4:135465708-135465730 CAGTGAGAACAGCTGTTAGAAGG + Intergenic
980707572 4:136519785-136519807 CAGTGAAAGCAGCTGGGAGGGGG - Intergenic
980742693 4:136973142-136973164 CAGTGAAAACAGCTGGGAGGGGG - Intergenic
980846701 4:138333107-138333129 CTGTGAAAAAAGCCAGGAGGGGG - Intergenic
981373869 4:143991507-143991529 CTGTGAAAGCAGCCGAGAGCGGG - Intergenic
981608537 4:146566938-146566960 ATATGAAAACAGTTGCGAGATGG - Intergenic
981941210 4:150283255-150283277 CTGTGAAGGCAGCAGGGAGGTGG - Intronic
982140315 4:152311056-152311078 ATGGGAAAACAGGTTGGAGAGGG + Intergenic
982204899 4:152990222-152990244 CTGTGAATACTGATGGGTGATGG + Intergenic
982219420 4:153112095-153112117 CTGTAAAGACAGCTGTGAGCTGG + Intergenic
983236658 4:165187835-165187857 CTGTGAAAGCAGCCAGGAGGAGG - Intronic
983718537 4:170816467-170816489 CTGTAAAAGCAGCTAGGAGTGGG + Intergenic
983766402 4:171489724-171489746 GTGTGAAAACAGCTGGGTGGGGG + Intergenic
983889546 4:173016380-173016402 CTGCGAAAGCAGCTGGGAGGGGG + Intronic
984943629 4:184954643-184954665 CTGTGAGGACACCGGGGAGACGG - Intergenic
985155933 4:186987270-186987292 CTGTGAAAGCAGTCAGGAGAGGG - Intergenic
985225072 4:187751316-187751338 CTGTGAAAGCAGCTGGGTGGGGG + Intergenic
985394362 4:189525958-189525980 TTGTGAAAGCAGCTGGAAGGGGG + Intergenic
985431775 4:189888122-189888144 CTGTGAAAGCAGCCAGGAGAAGG - Intergenic
985475334 5:75616-75638 CTGTGAAAACACCGGGTGGATGG + Intergenic
985723994 5:1506181-1506203 CTGTGAAAACTGCTTGGAGAGGG + Intronic
985989780 5:3546159-3546181 ATATGAACACAGCTGGGAGGAGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986398139 5:7351081-7351103 GTGTGAAAACAATTGAGAGAAGG - Intergenic
986507745 5:8470467-8470489 CAGTGAAAGCACATGGGAGAGGG - Intergenic
986798155 5:11232349-11232371 CTGTGAAAGCAGCTGGGAGTGGG + Intronic
986965623 5:13267440-13267462 CTGGGGAAGCAGCTGGGAGGGGG - Intergenic
987216531 5:15743534-15743556 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
987226008 5:15842133-15842155 CAGTGAAAGCAGCTGGGAGGGGG + Intronic
987448598 5:18053648-18053670 TTGTGAATACATTTGGGAGAGGG - Intergenic
987472533 5:18350907-18350929 CTGTGAAAGTGTCTGGGAGAGGG + Intergenic
988170781 5:27652661-27652683 CTGTGACAACAGCCAGGAGGTGG + Intergenic
988221185 5:28348943-28348965 CTGTGAAAGCAGCCAGGAGGAGG - Intergenic
988319177 5:29670203-29670225 CTATGAAAGCAGCTGGGAAGGGG + Intergenic
988665460 5:33322399-33322421 CTGTGAAAATAACTGGGTGGAGG - Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
988911164 5:35845466-35845488 CCATGAAAGCAGCTGGGAGTGGG - Intergenic
988958046 5:36338838-36338860 TTGTGAAGGCAGCAGGGAGAGGG - Intergenic
989116635 5:37960534-37960556 CTGGGCAAAGAGCTTGGAGAAGG + Intergenic
989132740 5:38124012-38124034 CTGTGAAACCAGCCAGGAGGGGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989501833 5:42177205-42177227 CTTTGAAAGCAGCTGGAAGGGGG - Intergenic
989787020 5:45344767-45344789 CCATGAAAGCAGCTGGTAGATGG - Intronic
989984883 5:50686402-50686424 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
992311001 5:75498912-75498934 CTGTGAAAGCAGCCAGGAGGGGG + Intronic
992599617 5:78385615-78385637 CTATCAAAACCGCTGGGAAATGG - Intronic
993037027 5:82769608-82769630 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
993478945 5:88398638-88398660 ATCTGAAAACTGCTGGGAGGTGG + Intergenic
993703944 5:91148782-91148804 TTGTGAAAGCAGCTGGGAGGGGG + Intronic
993711514 5:91230099-91230121 CCATGAAAGCAGCTGGGAGGAGG - Intergenic
993967125 5:94372167-94372189 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
994464446 5:100109110-100109132 CCATGAAGACAGCTGGGAGGGGG + Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
994689481 5:102999368-102999390 CTGTGAAAGCAGCTGAGAGGAGG - Intronic
995055457 5:107754089-107754111 CTGTGAAGGAAGCTGGGAGGGGG + Intergenic
995392356 5:111653173-111653195 CCGTGAAAGCAGCTGGGGGGAGG - Intergenic
995828580 5:116329204-116329226 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
996179346 5:120399912-120399934 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
996246532 5:121271175-121271197 CTGTGAAAGCAGCCAGGAGGAGG - Intergenic
996321288 5:122220260-122220282 AAGTGAAAAAAGCTGGGTGAAGG + Intergenic
996798436 5:127376387-127376409 CTGAGAAGACAGCTGGCAGATGG + Intronic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997021991 5:130013207-130013229 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
997086525 5:130806437-130806459 CTGTGAAAACAGCCAGGAGTGGG + Intergenic
997525589 5:134551050-134551072 TTATGCAAACAGCTGGGGGACGG - Intronic
998501919 5:142640591-142640613 CTTGGATAACAGCTGGAAGAAGG - Intronic
998725047 5:145003013-145003035 ATGTGAAAGCAGCTTGGAGCTGG + Intergenic
998980602 5:147698025-147698047 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1000488296 5:161876695-161876717 TTGGGAAAAAAGCAGGGAGAAGG - Intronic
1000581086 5:163035898-163035920 CTGTGGAAACAGCTGGGAAGGGG + Intergenic
1000676281 5:164126620-164126642 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1000751334 5:165099613-165099635 CTGGGAAAGCAGCTAGGAGCGGG - Intergenic
1002213784 5:177613655-177613677 CTGTGAAGACACCAGGGATACGG + Intergenic
1002464622 5:179400666-179400688 TTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1003125017 6:3349107-3349129 TTCTGCAAACAGCTGGGTGATGG + Intronic
1003546361 6:7062769-7062791 CTTTGAAAACAGCTTTGAAAAGG + Intergenic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1004338091 6:14783109-14783131 CTGTGGAAACACCTGCGAGCAGG + Intergenic
1005095461 6:22110022-22110044 CTGTGACTCCAGCTTGGAGAGGG - Intergenic
1005153645 6:22779700-22779722 CTGTGAAAGCAGCTGAGAGGGGG + Intergenic
1005499557 6:26418050-26418072 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1005941496 6:30563539-30563561 CTGTGAAAACAGCAGTGAACAGG + Exonic
1006112608 6:31757637-31757659 CTGTGAGCACATCTGGGACAGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007727058 6:43922931-43922953 CAGGGCAACCAGCTGGGAGATGG + Intergenic
1007941635 6:45786853-45786875 CTGGGGAAACAGCTCTGAGAAGG + Intergenic
1007945846 6:45826283-45826305 CTTGGATAACAGATGGGAGATGG + Intergenic
1008137584 6:47794967-47794989 AAGTGACAACAGCTGGGAAAAGG - Intronic
1008248410 6:49207418-49207440 CTGTGAAAGCAGCCTGGAGGGGG - Intergenic
1008298766 6:49808522-49808544 TCGTGAAAGCGGCTGGGAGAGGG - Intergenic
1008363651 6:50650416-50650438 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
1009284919 6:61804364-61804386 CCATGAACACAGCTGGGAGGGGG - Intronic
1009532901 6:64843382-64843404 CTGTGAAAGCAGCCCGGAGGTGG + Intronic
1009538613 6:64923876-64923898 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
1010048322 6:71473403-71473425 CAGGGAAAAGAGCTTGGAGATGG - Intergenic
1010055171 6:71556498-71556520 CCATGAAAGCAGCTGGGAGAGGG + Intergenic
1010630149 6:78189439-78189461 CTGTGAAGGCAGCTGGAAGGTGG - Intergenic
1010773651 6:79861211-79861233 CTGTGAAGACAGCAGAGTGAGGG - Intergenic
1010835879 6:80586900-80586922 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1010882987 6:81202159-81202181 CTGTGAAGGCAGCCAGGAGAAGG + Intergenic
1010986875 6:82434822-82434844 CTGGGAAAACTGCTTGGAAAAGG + Intergenic
1011169411 6:84489372-84489394 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011211265 6:84958869-84958891 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
1011385745 6:86796225-86796247 CTGTGAAAGCAGCCTGGAGGGGG - Intergenic
1011784259 6:90826550-90826572 GTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1011956371 6:93029560-93029582 CTGTGAAAGCACCTGAGAGGGGG - Intergenic
1012029261 6:94037337-94037359 CTGTGAAAGAAGCTGAGAGGGGG + Intergenic
1012064838 6:94537272-94537294 CTGTGAAAGCAGCTAGGAGGTGG - Intergenic
1012281106 6:97328933-97328955 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1012369386 6:98484508-98484530 CTTTTAAAACAGCTAGGAGCTGG + Intergenic
1012531394 6:100241800-100241822 ATGAGAAGACAGCAGGGAGATGG - Intergenic
1012732357 6:102899239-102899261 CCATGAAAGCAGCTGGGAGGTGG - Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1013080032 6:106804378-106804400 ACTTGAAAAAAGCTGGGAGAGGG - Intergenic
1013151139 6:107447625-107447647 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1013213625 6:108008085-108008107 CCATGAAAGCAGCTGGGAGAGGG - Intergenic
1013717242 6:112976397-112976419 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
1013910744 6:115272944-115272966 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1014143563 6:117971350-117971372 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1014407515 6:121069416-121069438 CTGTTAAAGCAGCTAGGAGCGGG + Intergenic
1014449425 6:121565811-121565833 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
1014470041 6:121802139-121802161 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
1014563073 6:122914214-122914236 CTGAGAAAGCAGCTAGGAGGGGG + Intergenic
1014721221 6:124920521-124920543 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1015039903 6:128703993-128704015 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1015110661 6:129588544-129588566 CTGTGAAAGCAGCCGGGAGGGGG - Intronic
1015351604 6:132225888-132225910 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016045569 6:139477070-139477092 CTGGGAAGACACCTTGGAGAAGG + Intergenic
1016053212 6:139551721-139551743 AAATGAAAAAAGCTGGGAGATGG + Intergenic
1016143585 6:140643632-140643654 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016611907 6:145999529-145999551 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1016790163 6:148059825-148059847 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1017043310 6:150324903-150324925 CTGGGAGGACAGCTGGGTGATGG + Intergenic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017763757 6:157590830-157590852 CCGTGAAAGCAGTTGGGAGGGGG + Intronic
1018416277 6:163604926-163604948 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
1018489753 6:164279841-164279863 CCATGAAAGCAGCTGGGAGGCGG + Intergenic
1018514352 6:164562312-164562334 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
1018676210 6:166224218-166224240 CTGAGATAAGAGCTGGGACACGG + Intergenic
1018726890 6:166619643-166619665 GTGTGAGAAAAGCTGGGAGCCGG - Intronic
1018922651 6:168186199-168186221 CCATGAAAGCAGCTGGGAGGAGG - Intergenic
1018951753 6:168382861-168382883 CTGTGACCACAGCTGGGTGGGGG - Intergenic
1019086889 6:169486813-169486835 CTGTGAAAACATCGAGGAAAAGG - Intronic
1019602125 7:1889982-1890004 CTGTGAAGGCAGCTGGGAGGTGG + Intronic
1020649584 7:10857964-10857986 CTGCAATAACAGATGGGAGAAGG + Intergenic
1020869355 7:13607949-13607971 CTGTGAAGGAAGCTGGGAGAGGG + Intergenic
1021323430 7:19239547-19239569 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1021573267 7:22085789-22085811 CTGTGAAAACAGCCAGGAAGAGG - Intergenic
1021682325 7:23146354-23146376 CTATGAAGACAGCTGGCAGATGG - Intronic
1022430053 7:30309998-30310020 CTGTGACAACAGTTTGGGGAAGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023634437 7:42195475-42195497 CTGTAAAAACAGATGTGAGGAGG - Intronic
1024069820 7:45776075-45776097 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
1024416044 7:49108091-49108113 CTGTGAAAGCAGCCAGGAGGAGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026895596 7:74008302-74008324 CGATGTAAACAGCTGGGAGCGGG + Intergenic
1027506415 7:79021377-79021399 CTGTGAAAGCGGCTGGGAGGGGG + Intronic
1027530161 7:79320935-79320957 CTTTGAAACATGCTGGGAGAAGG + Intronic
1027733873 7:81907900-81907922 CCATGAAAGCAGCTGGGAGAGGG - Intergenic
1027977634 7:85179318-85179340 CTGTGAAAGCAGCCAGGAGTGGG + Intronic
1028032467 7:85933214-85933236 CCATGAAGGCAGCTGGGAGAAGG + Intergenic
1028048445 7:86152578-86152600 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
1028084271 7:86617175-86617197 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1028598827 7:92578569-92578591 CTTTGAAAAGAGCTAGTAGAGGG - Intronic
1028882037 7:95891134-95891156 ATGTGAAAAAAACAGGGAGAAGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030580312 7:111346956-111346978 CTGTGATAATAGATGGCAGAGGG + Intronic
1030650730 7:112113289-112113311 CTGGTAAAACAGCTGGGATGAGG + Intronic
1030722340 7:112884687-112884709 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1030986150 7:116244561-116244583 CAATGAAAGCAGCTGGGAGTGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031790087 7:126092130-126092152 CTGTGAATACAGCTGGGAAGGGG - Intergenic
1031909939 7:127505443-127505465 ACATGAAAACAGCTGGGAGAGGG - Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032047210 7:128620361-128620383 CTGTGGAAGCAGCTAGGTGAGGG - Intergenic
1032664546 7:134022701-134022723 CTGTTAAAACAGCTGCCAAAAGG - Intronic
1032808269 7:135380531-135380553 CTGTGACAACAGCTGCCAGCTGG + Intronic
1033031546 7:137832095-137832117 CTGTGGAAGCAGCCAGGAGAGGG - Intronic
1033587548 7:142785922-142785944 ACGTGACAACAGCTTGGAGAGGG + Intergenic
1034161658 7:148998288-148998310 TTTAGAAAACAGCTTGGAGAAGG - Intergenic
1034737836 7:153445577-153445599 ATGAGAAAACAGCGTGGAGAAGG + Intergenic
1034749995 7:153559764-153559786 CTGTGAAAGCAACTGGGAGGGGG - Intergenic
1034812375 7:154145065-154145087 TTGAGTAAACAACTGGGAGATGG - Intronic
1035052627 7:156009510-156009532 CAGTGAAAACATCTGGGACTGGG + Intergenic
1036126720 8:6069787-6069809 ATGAGGACACAGCTGGGAGATGG - Intergenic
1036610652 8:10347046-10347068 CTGTGAAAACACATTGGAGGGGG - Intronic
1036981533 8:13474584-13474606 CCGTGAAAGCAGCTGGGAGAGGG + Intronic
1037979064 8:23237743-23237765 TTGTGAAAACAGCCAGGACAAGG - Intergenic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1038139089 8:24822849-24822871 CTGTGAAAGCAGCCGGGAGTGGG + Intergenic
1038183772 8:25253441-25253463 GTGTGAAGACAGCTGTGAGCAGG - Intronic
1038680020 8:29658208-29658230 CAGTGCAAACAGCTGGGAATTGG + Intergenic
1038889007 8:31697504-31697526 CTTTCAAGACAGCTGGGAGTTGG - Intronic
1039082282 8:33745070-33745092 CTGTGAAAGCAGCCCGGAGGTGG - Intergenic
1039107364 8:34003997-34004019 CTGTGAAAGCAACTGGGGTAAGG - Intergenic
1039960929 8:42247150-42247172 TTGTGAAAGCAGCTGGCAGTCGG + Intergenic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041430725 8:57778044-57778066 CTATGAAAGCATCTGGGAGGGGG + Intergenic
1041443175 8:57920391-57920413 CTGTGAAAACTCCTGGCAGCTGG + Intergenic
1041781297 8:61580126-61580148 CCATGAAAGCAGCTGGGAGGGGG - Intronic
1041852127 8:62403912-62403934 CCATGAAAGCAGCTGGGAGGGGG + Intronic
1041984782 8:63909129-63909151 CTGTGAAAGCAGCTGGGAGGTGG - Intergenic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042407491 8:68422541-68422563 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
1042631468 8:70821336-70821358 CTGTGAAAGCAGCCAGGACAGGG - Intergenic
1042827221 8:72991438-72991460 CTGTGAAAGCAGCCGGGAGTGGG + Intergenic
1043345869 8:79297059-79297081 CTGTGAAAGCAGTTGAGAGGGGG + Intergenic
1043518603 8:81019891-81019913 CTGTGAAAGCAGCCAGGAGTGGG + Intronic
1043940400 8:86189938-86189960 CTGTGAAAGCAGCCAGGAGCAGG - Intergenic
1043993176 8:86780950-86780972 CTGTGAAAGTAGCCAGGAGAGGG + Intergenic
1044055976 8:87570018-87570040 CTGTGACACCAGCCAGGAGAGGG + Intronic
1044303977 8:90616877-90616899 CTGTGAAAACAGCCAGGAGGTGG + Intergenic
1044732435 8:95240044-95240066 GTCTGAAAGCAGATGGGAGAGGG + Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045067273 8:98460099-98460121 CTGTGAAAGCAGCTGAGAGGAGG + Intronic
1045108917 8:98920845-98920867 CAGTGCAAAGAGCTGGGAGGAGG + Intronic
1045186054 8:99839314-99839336 CTGTGAAAACACTTGGTAAATGG - Intronic
1045849332 8:106674161-106674183 TAGCGAAAGCAGCTGGGAGAGGG + Intronic
1046107470 8:109683241-109683263 CTGTGAAAGCAGCCAGGAGTTGG + Intronic
1046170427 8:110498195-110498217 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1046180063 8:110633463-110633485 TTGTGAAAACAGCCGGGAGTGGG + Intergenic
1046470993 8:114673888-114673910 ATGTGAAAACACCTGTGAGAAGG + Intergenic
1046782855 8:118233799-118233821 CTGGTAAAACAGCTGGGTTAGGG + Intronic
1046880153 8:119298928-119298950 CTGTGAAAGCAGCCAGGATAGGG - Intergenic
1047153721 8:122294316-122294338 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1047918002 8:129603591-129603613 CCATGAAAGCAGCTGGGAGTGGG - Intergenic
1048041492 8:130733171-130733193 TTGAGGAAACAGCTGGGAGGGGG + Intergenic
1048116756 8:131532186-131532208 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1048240351 8:132735238-132735260 GTGTCAACACAGCTGGGAAAGGG + Intronic
1048439188 8:134447495-134447517 CTGTGTAGAAAGGTGGGAGAGGG + Intergenic
1048669128 8:136696352-136696374 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
1050121609 9:2314173-2314195 CTGTGAAAGCAGCCGGGAGTGGG + Intergenic
1050660343 9:7877199-7877221 CTGTGAAAGTAGCTGGGAGGAGG + Intronic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051798132 9:20899188-20899210 TTGTGATCACAGCAGGGAGAGGG - Intronic
1051915088 9:22198527-22198549 CTGTGAAAGCAGCTGAGAGGTGG + Intergenic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1052008909 9:23383092-23383114 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1052105593 9:24510604-24510626 CCATGAAAGCAGCTGGGAGGAGG + Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1052846355 9:33339955-33339977 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1053371389 9:37564501-37564523 CTGTGAAAGCAGCCAGGAGGTGG + Intronic
1053720942 9:40946160-40946182 CTGTGAAAGCAGCCAGGAGGAGG - Intergenic
1054345050 9:63905996-63906018 CTGTGAAAGCAGCCAGGAGGAGG + Intergenic
1055097859 9:72432879-72432901 TTGTGAAAGCAGCTGGCACATGG - Intergenic
1055341847 9:75292742-75292764 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1055351947 9:75398763-75398785 CTTTGAAAAAAATTGGGAGATGG - Intergenic
1055595615 9:77862096-77862118 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1055679921 9:78704429-78704451 CTGTGAAAGCAGTTGGGAGGGGG + Intergenic
1055713286 9:79088754-79088776 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1056064137 9:82915964-82915986 CTGTGAAAGCAGCCGGGATGGGG - Intergenic
1056283987 9:85069732-85069754 CTGTGAAAGCAGCCGGGAGGGGG + Intergenic
1056742933 9:89275758-89275780 CTGTGAAAGCAGCCAGGAGGTGG - Intergenic
1056915012 9:90738818-90738840 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1057035336 9:91807863-91807885 CTGTCAGATCAGCTTGGAGAGGG - Intronic
1057066375 9:92055996-92056018 CTGATAACAAAGCTGGGAGAAGG + Intronic
1057143986 9:92746189-92746211 ATGTGAATACAGTGGGGAGAGGG + Intronic
1057727121 9:97575521-97575543 GTGTGTAAACAGCTGGGAGATGG + Intronic
1058223064 9:102326197-102326219 CCATGAAAACAGCTGTGAGGGGG + Intergenic
1058245891 9:102625202-102625224 CTGTGAAAGCAGCCGGGAGGGGG - Intergenic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059195459 9:112366868-112366890 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1059722793 9:116977654-116977676 ATATGACAACAGCTGGGAGTAGG - Intronic
1059928952 9:119241904-119241926 CAGTCAAAGCAGCTGGCAGAGGG + Intronic
1060401120 9:123350116-123350138 CTGGCAAAACAGCTTGGGGAGGG - Intergenic
1060881132 9:127118892-127118914 CTGAGAAAACATCAGGGAGATGG - Intronic
1060913722 9:127371121-127371143 GTGGGAAGACAGCTTGGAGATGG - Intronic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061254006 9:129443201-129443223 CTGTGCCCCCAGCTGGGAGAAGG + Intergenic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1186704578 X:12128019-12128041 CTGTGGAAACAGCTGGGAGGTGG - Intergenic
1187097160 X:16161342-16161364 CTGTGAAAGCAGCCAGGAGGGGG - Intergenic
1187796141 X:23006354-23006376 CCATGAAAGCAGCCGGGAGAGGG - Intergenic
1187979397 X:24739064-24739086 ATGGGAAAACAGCAGGGTGAGGG - Intronic
1188041758 X:25376797-25376819 CTGTGAAGGCAACTGGGAGGGGG + Intergenic
1188127158 X:26383518-26383540 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1188162399 X:26819761-26819783 CCATGAAAGCAGCTGGTAGAGGG + Intergenic
1188196452 X:27240709-27240731 CTGTGAAAGCAGCCAGGAGTGGG + Intergenic
1188616561 X:32165254-32165276 CTGTAAAAGCAGCCAGGAGAGGG + Intronic
1188943124 X:36264252-36264274 CTGAGACACCAGCTGGGTGAGGG - Intronic
1189071253 X:37866373-37866395 CTGTGAAAGCAGCCGGGGGTTGG - Intronic
1189176510 X:38963187-38963209 CCATGAAAGCAGCTGGGAGAGGG - Intergenic
1189293304 X:39901140-39901162 CTGTGAAAACAGCCTGGCGGTGG - Intergenic
1189551259 X:42095978-42096000 CTCTGCAAAGAGCAGGGAGAAGG + Intergenic
1189788767 X:44583627-44583649 CCGTGAAAGCAGCTGGGAAAGGG + Intergenic
1189896209 X:45659043-45659065 CTGTGAAAGCAGCCTGGAGGGGG + Intergenic
1189942219 X:46136535-46136557 TTATGGAAACAGCAGGGAGAGGG - Intergenic
1190083369 X:47374247-47374269 CTGTGACAACAGATGAGTGAGGG - Intronic
1190441372 X:50478088-50478110 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1191971084 X:66817029-66817051 CTGTGAAAATATCTGGGGAAAGG + Intergenic
1192841984 X:74866120-74866142 CGGTGAAAGCAGCTGGGAGGGGG + Intronic
1193043087 X:77024364-77024386 CTGTGAAGGCAGCTAGGAGGGGG - Intergenic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1193236579 X:79114298-79114320 CTGTGAAGGCAGCTGGGAGCAGG - Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193430145 X:81392057-81392079 CTGGTGGAACAGCTGGGAGATGG + Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1194274063 X:91857796-91857818 CTATGAAATCAGCCAGGAGAGGG - Intronic
1194457777 X:94125599-94125621 CTGTAAGGACACCTGGGAGATGG - Intergenic
1194500536 X:94676353-94676375 CCATGAAAGCAGCTGGGAGGGGG - Intergenic
1194920653 X:99760311-99760333 CTGTTAAAGCAGCTAGGAGGGGG + Intergenic
1195206990 X:102611102-102611124 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195596199 X:106692964-106692986 CTGTGAAAATTGCTGGGATGGGG - Intergenic
1195608305 X:106834892-106834914 CTGTGAAAGCAGCCAGGAGGGGG - Intronic
1195838882 X:109150355-109150377 CTGTGAAAGCAGCCAGGAGGGGG + Intergenic
1196173697 X:112617257-112617279 CTGTGAAAGCAGCTGGGAAGAGG + Intergenic
1197040712 X:121932373-121932395 CCGTGAAAGCAGCTGGGAGGGGG - Intergenic
1197379477 X:125721959-125721981 CTGTGAAAGCAGCCAGGAGGCGG + Intergenic
1197499134 X:127222468-127222490 CCATGAAAGCAGCTGGGAGCAGG + Intergenic
1197581950 X:128294572-128294594 CCGTGAAAGCAGCTGGGAGAAGG + Intergenic
1198274726 X:135089794-135089816 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1198612563 X:138418213-138418235 CTGTGAAAGCAGCCAGGAGCAGG + Intergenic
1198775327 X:140173063-140173085 CTGTGAAAGCATCTGGGAGGGGG + Intergenic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1198882485 X:141296020-141296042 CAGTCAAAGCAGCTGGGAGCGGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1198913355 X:141638238-141638260 CTGTGAAAGCAGCTGAGAGTGGG - Intronic
1199046259 X:143177344-143177366 CCATGAAAACAGCTGAGATAGGG - Intergenic
1199070361 X:143468840-143468862 CTGTGAAAGCAGCTGGGTGGGGG - Intergenic
1199072710 X:143497754-143497776 CTATGAAAGCTGCTGGGAGGGGG - Intergenic
1199112867 X:143955594-143955616 CTATGAAAGCAGCTGGGAGGGGG + Intergenic
1199170892 X:144733374-144733396 CCGTGAAAACAGCTGGGAGGGGG - Intergenic
1199185428 X:144910380-144910402 CTGTGAAAGCAGTTGGGAGGGGG - Intergenic
1199220274 X:145309283-145309305 CCGTGAAAGCAGCCGGGAGGGGG - Intergenic
1199231685 X:145443822-145443844 CTGTGAAAGCAGCCAGGAGCGGG + Intergenic
1199357223 X:146876093-146876115 CCATGAAAGCAGCTGGGAGTGGG + Intergenic
1199476787 X:148254858-148254880 CCATGAAAGCAGCTGGGAGGGGG + Intergenic
1199687026 X:150273756-150273778 CCGTGAAAGCAGCTGGGAGGGGG + Intergenic
1199776066 X:151013084-151013106 ACGTGAATGCAGCTGGGAGAGGG - Intergenic
1199908705 X:152261690-152261712 CCATGAAAACAACTGGGAGGGGG - Intronic
1199909700 X:152272210-152272232 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1199928484 X:152494360-152494382 CCGTGGAAACATCTGGGAGGGGG + Intergenic
1199999371 X:153049758-153049780 CTGTGAAAGCAGCTGGGAAGGGG + Intergenic
1200591297 Y:5079207-5079229 CTGTGAAATCAGCCAGGAGAGGG - Intronic
1200833794 Y:7713046-7713068 CTGTGGAAACAGCTTCAAGATGG + Intergenic