ID: 1198915313

View in Genome Browser
Species Human (GRCh38)
Location X:141664319-141664341
Sequence AGTAGGCTCAAAGGTTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198915313_1198915319 26 Left 1198915313 X:141664319-141664341 CCACTCCAACCTTTGAGCCTACT No data
Right 1198915319 X:141664368-141664390 AACTTTCACTTAAGTGGTAATGG No data
1198915313_1198915321 28 Left 1198915313 X:141664319-141664341 CCACTCCAACCTTTGAGCCTACT No data
Right 1198915321 X:141664370-141664392 CTTTCACTTAAGTGGTAATGGGG No data
1198915313_1198915320 27 Left 1198915313 X:141664319-141664341 CCACTCCAACCTTTGAGCCTACT No data
Right 1198915320 X:141664369-141664391 ACTTTCACTTAAGTGGTAATGGG No data
1198915313_1198915318 20 Left 1198915313 X:141664319-141664341 CCACTCCAACCTTTGAGCCTACT No data
Right 1198915318 X:141664362-141664384 GTAAACAACTTTCACTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198915313 Original CRISPR AGTAGGCTCAAAGGTTGGAG TGG (reversed) Intronic