ID: 1198921470

View in Genome Browser
Species Human (GRCh38)
Location X:141733340-141733362
Sequence TGAATCATTACAGCATAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198921470_1198921474 29 Left 1198921470 X:141733340-141733362 CCCCATTATGCTGTAATGATTCA No data
Right 1198921474 X:141733392-141733414 CTATTTTGCTCATTTTTCAAGGG No data
1198921470_1198921473 28 Left 1198921470 X:141733340-141733362 CCCCATTATGCTGTAATGATTCA No data
Right 1198921473 X:141733391-141733413 ACTATTTTGCTCATTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198921470 Original CRISPR TGAATCATTACAGCATAATG GGG (reversed) Intergenic
No off target data available for this crispr