ID: 1198921473

View in Genome Browser
Species Human (GRCh38)
Location X:141733391-141733413
Sequence ACTATTTTGCTCATTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198921472_1198921473 26 Left 1198921472 X:141733342-141733364 CCATTATGCTGTAATGATTCATA No data
Right 1198921473 X:141733391-141733413 ACTATTTTGCTCATTTTTCAAGG No data
1198921471_1198921473 27 Left 1198921471 X:141733341-141733363 CCCATTATGCTGTAATGATTCAT No data
Right 1198921473 X:141733391-141733413 ACTATTTTGCTCATTTTTCAAGG No data
1198921470_1198921473 28 Left 1198921470 X:141733340-141733362 CCCCATTATGCTGTAATGATTCA No data
Right 1198921473 X:141733391-141733413 ACTATTTTGCTCATTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198921473 Original CRISPR ACTATTTTGCTCATTTTTCA AGG Intergenic