ID: 1198921474

View in Genome Browser
Species Human (GRCh38)
Location X:141733392-141733414
Sequence CTATTTTGCTCATTTTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198921472_1198921474 27 Left 1198921472 X:141733342-141733364 CCATTATGCTGTAATGATTCATA No data
Right 1198921474 X:141733392-141733414 CTATTTTGCTCATTTTTCAAGGG No data
1198921471_1198921474 28 Left 1198921471 X:141733341-141733363 CCCATTATGCTGTAATGATTCAT No data
Right 1198921474 X:141733392-141733414 CTATTTTGCTCATTTTTCAAGGG No data
1198921470_1198921474 29 Left 1198921470 X:141733340-141733362 CCCCATTATGCTGTAATGATTCA No data
Right 1198921474 X:141733392-141733414 CTATTTTGCTCATTTTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198921474 Original CRISPR CTATTTTGCTCATTTTTCAA GGG Intergenic