ID: 1198928018

View in Genome Browser
Species Human (GRCh38)
Location X:141821560-141821582
Sequence GGCCCAAATCCTGGTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198928010_1198928018 30 Left 1198928010 X:141821507-141821529 CCTTCAACTACCTCAAACAATGG No data
Right 1198928018 X:141821560-141821582 GGCCCAAATCCTGGTGGTACTGG No data
1198928013_1198928018 20 Left 1198928013 X:141821517-141821539 CCTCAAACAATGGGCATAAGTTT No data
Right 1198928018 X:141821560-141821582 GGCCCAAATCCTGGTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198928018 Original CRISPR GGCCCAAATCCTGGTGGTAC TGG Intergenic
No off target data available for this crispr