ID: 1198928500

View in Genome Browser
Species Human (GRCh38)
Location X:141825800-141825822
Sequence ATTGGTCACCAGGTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198928495_1198928500 8 Left 1198928495 X:141825769-141825791 CCATTCTTTCACTTGCTGTCTTT No data
Right 1198928500 X:141825800-141825822 ATTGGTCACCAGGTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198928500 Original CRISPR ATTGGTCACCAGGTGATGCA GGG Intergenic
No off target data available for this crispr