ID: 1198929505

View in Genome Browser
Species Human (GRCh38)
Location X:141838526-141838548
Sequence CAAGACAGTGTGCAGTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198929501_1198929505 19 Left 1198929501 X:141838484-141838506 CCAGCTCTTCTTTTGCATCTCAG 0: 1
1: 0
2: 8
3: 42
4: 378
Right 1198929505 X:141838526-141838548 CAAGACAGTGTGCAGTCTGTTGG 0: 1
1: 1
2: 1
3: 22
4: 143
1198929503_1198929505 -4 Left 1198929503 X:141838507-141838529 CCTCAGTGTTGCTTGGCTCCAAG 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1198929505 X:141838526-141838548 CAAGACAGTGTGCAGTCTGTTGG 0: 1
1: 1
2: 1
3: 22
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198929505 Original CRISPR CAAGACAGTGTGCAGTCTGT TGG Intronic
900759927 1:4463644-4463666 CTGGACAGGGTGCAGTGTGTCGG - Intergenic
903582736 1:24384336-24384358 CAAGTCAGTGTGCAGTGATTGGG + Intronic
906929052 1:50150586-50150608 CATGACAGAGTACAGTCTATTGG + Intronic
908266583 1:62385324-62385346 CAGCAGAGTGTTCAGTCTGTGGG + Intergenic
911924780 1:103816614-103816636 CAGGGCAGTGTGCAGTCTGTTGG - Intergenic
916983790 1:170168270-170168292 CAAGACAGTTTGGAATATGTGGG - Intergenic
919990598 1:202706359-202706381 CAAGACAGTGTTGTGTGTGTGGG + Intronic
1062822034 10:541828-541850 CTAGACAGGGTGCAGTCAGGTGG - Intronic
1065041901 10:21705737-21705759 TAGGACAGTGTGTAGCCTGTTGG + Intronic
1069081125 10:64089206-64089228 CAAGATTGTATGCAGTATGTTGG + Intergenic
1072951542 10:99850763-99850785 CATGATGGTGTGCAGCCTGTGGG - Exonic
1076086641 10:127637653-127637675 CAGGGCAGGGTGCAGTCTGGTGG + Intergenic
1078977437 11:16494983-16495005 CAAGGCAGGATGCAGTCTGGAGG - Intronic
1080938687 11:36889523-36889545 TAAGACAGGCTGCAGGCTGTGGG - Intergenic
1081295739 11:41386723-41386745 GAAGACATTATTCAGTCTGTTGG - Intronic
1081817341 11:45955496-45955518 CAAGGCTGTGTGAAGTCTCTTGG + Intronic
1081989347 11:47329383-47329405 CAAGAATGTGTACAGTCTGTGGG + Exonic
1082040320 11:47679502-47679524 GTAGACAGTATGCAGTCTGGGGG + Intronic
1082813505 11:57493295-57493317 CAAAACGGTGTGCAGTTTGAGGG - Intronic
1082868389 11:57920477-57920499 CAGGACAGTGTGCAATCTATTGG - Intergenic
1084998964 11:73011532-73011554 CAGGACAGTGCACAGTCTGTTGG + Intronic
1085593652 11:77789380-77789402 CAGGACAATGGGCAGTCTGTTGG - Intronic
1086123551 11:83326540-83326562 CAGGGCAGTGTGTGGTCTGTTGG + Intergenic
1089353749 11:117836639-117836661 CAAGACAGTGTGCAATGTACAGG + Intronic
1089372503 11:117971310-117971332 CAAGGCAGTGTGCAGGATGCTGG - Intergenic
1091644034 12:2260011-2260033 CACACCAGTGTGCAGTCTGGTGG - Intronic
1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG + Intronic
1094313523 12:29112896-29112918 CAAGACAGAATGCAGTCTGGTGG + Intergenic
1099005112 12:77226442-77226464 CAAGACAGAAGGCAGTCTGCTGG + Intergenic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1104241752 12:126996767-126996789 CAAGACAGAGTCCATTCAGTGGG + Intergenic
1104359394 12:128117693-128117715 CACGTCACTGTGCACTCTGTGGG - Intergenic
1104872085 12:132007142-132007164 CAGGTCACTGTGCAGTGTGTGGG + Intronic
1104978750 12:132563435-132563457 CCAGACATGGTGCAGGCTGTGGG - Intronic
1108900789 13:55405506-55405528 GAAGACATTGTGCTGTCTCTTGG - Intergenic
1111531354 13:89541509-89541531 CAAGAAAGGGTGTAGCCTGTTGG - Intergenic
1111721802 13:91955794-91955816 CAGGACAGGATACAGTCTGTTGG - Intronic
1117618674 14:57561523-57561545 CAAGATATTCTGCACTCTGTGGG - Intergenic
1118183477 14:63517366-63517388 CAAGACAGTGTGCATTCCTGTGG - Intronic
1118824180 14:69365601-69365623 CAACACACTCTGCAGCCTGTTGG + Intergenic
1120290135 14:82558504-82558526 TGATACAGTATGCAGTCTGTAGG + Intergenic
1120581116 14:86250599-86250621 GAAGTCAGTGTGCACTCTCTGGG - Intergenic
1121086077 14:91147009-91147031 CAAGACAGTGAGAAGCCTCTGGG - Intronic
1121457191 14:94046021-94046043 CAAGAAAATGTGCAGCCTTTTGG + Exonic
1122037061 14:98956528-98956550 CAAGTCAGAGTGCAGCCTGGTGG - Intergenic
1124355757 15:28993680-28993702 GAAGTCAGTGTGAAGCCTGTGGG + Intronic
1124984638 15:34595027-34595049 CAAGAAATTGTGAAGTGTGTAGG + Intergenic
1125204296 15:37134874-37134896 CAAAACAGAGTGCATTCTATGGG - Intergenic
1127629232 15:60811102-60811124 CAGGACAGTGTGCAAACAGTGGG - Intronic
1129335751 15:74851179-74851201 CCAGACAGGGGGCAGCCTGTGGG + Intronic
1129869083 15:78929383-78929405 GAAGACAGAGTGGAGGCTGTTGG + Intronic
1130548846 15:84876291-84876313 AAACACAGTGTCCAGTCTATTGG - Intergenic
1130632598 15:85583692-85583714 CAAGCAAGTGTGAACTCTGTGGG + Intronic
1131019196 15:89083989-89084011 CATGACATGGTGCAGTCTGAGGG - Intergenic
1132364098 15:101243529-101243551 AAAGCCAGTGTGGAGGCTGTGGG - Intronic
1135584119 16:23654784-23654806 CAAGACAGAGAGTAGACTGTTGG - Intronic
1140634429 16:76894364-76894386 CATGACAGGTTGCAGACTGTGGG + Intergenic
1141403564 16:83772030-83772052 CAACACAATGTACACTCTGTGGG + Intronic
1142785408 17:2218119-2218141 CAAGAGAGTAGGCTGTCTGTGGG - Intronic
1147034115 17:37667337-37667359 CAAGACAGAGCAAAGTCTGTGGG + Intergenic
1149627516 17:58090291-58090313 CAGGACAGTGTGGAATCTCTAGG + Exonic
1155924826 18:31644304-31644326 CAAGACAATGTGCTCTGTGTTGG + Intronic
1156059308 18:33054434-33054456 CAACACACAGTGCAGCCTGTTGG - Intronic
1158702521 18:59761491-59761513 CTAGCCTGTTTGCAGTCTGTGGG + Intergenic
1160388365 18:78511936-78511958 CAGGACAGGGCACAGTCTGTTGG - Intergenic
929812241 2:45200598-45200620 CAGGACAGGATGCAGTCTGATGG - Intergenic
934747369 2:96768329-96768351 TCAGACACTGTGCAGGCTGTTGG + Intronic
937209799 2:120260957-120260979 CTACACAGTGTGGGGTCTGTGGG + Intronic
937885709 2:126898802-126898824 CAGGACAAAGTGCATTCTGTAGG - Intergenic
939233054 2:139455124-139455146 CAGGGCAGTGTATAGTCTGTTGG + Intergenic
939624097 2:144455349-144455371 CAAAACAGTGTGCAGGTTGGTGG - Intronic
942332568 2:174842704-174842726 CAGCACAGTGTCCAGTCTGTTGG + Intronic
942385407 2:175437885-175437907 TAAGAAAGTGTTCAGTCTCTGGG - Intergenic
944443838 2:199769630-199769652 CTTGCCAGTGTGCAATCTGTTGG + Intronic
945151292 2:206795134-206795156 CAAAACAGGGTGGAGTCTGATGG - Intergenic
947107157 2:226679583-226679605 CAAGACAGTATGCAGCCTGATGG - Intergenic
947766992 2:232644203-232644225 TAAGACAGTGAGCAGTCAGGAGG - Intronic
1171189396 20:23148279-23148301 CAAGACAGAGAGCAGTGTCTGGG + Intergenic
1173230550 20:41192710-41192732 CAGGACAGTGTACAGTCTTTTGG + Intronic
1174233742 20:49070183-49070205 CAAGTCAGTGTTTATTCTGTAGG + Exonic
1174251730 20:49225007-49225029 CAAGACAGTATGCAGCTTGTTGG + Intronic
1175396907 20:58671127-58671149 CAAGACAGTGCACAATGTGTTGG - Intronic
1180012992 21:45063726-45063748 CAAGACAATGTGGTGTCTGTGGG + Intergenic
1180154642 21:45972027-45972049 CAAGAGAATGTCCACTCTGTCGG - Intergenic
1181490164 22:23256528-23256550 CAGGACAATGTCCAGTCTGTTGG + Intronic
1181513660 22:23399923-23399945 CAGGCCAGTGTGCTGTCTGAGGG - Intergenic
1184406896 22:44305535-44305557 AAGGACAGTGTGCAGCCTGAAGG + Intronic
1184472524 22:44703699-44703721 TAAGACACTGTGCAGTCGTTGGG - Intronic
951068353 3:18295261-18295283 CAGGATAGTGTGCAGCCTGTTGG - Intronic
951333949 3:21398870-21398892 CAAGACAGTGTGAAGTCTGTTGG - Intergenic
952981087 3:38736728-38736750 CAAGAAAGTGTGTAGTTGGTGGG + Intronic
953452889 3:43018829-43018851 CAAGACCCAGTGCAGTCTTTTGG + Intronic
955611128 3:60758290-60758312 CAAGACAGAGTGCAGTACCTTGG - Intronic
955797886 3:62656652-62656674 CCAGACAATGTGCACTCTGTAGG + Intronic
955933987 3:64084877-64084899 TAAGACAGTGGACAGTCTCTAGG - Intergenic
958863656 3:99474309-99474331 CAAGACAGTGTGGTGTTTGTAGG - Intergenic
959769776 3:110079482-110079504 CAAGACTGTGAGCAGTCTGATGG + Intergenic
960836565 3:121912797-121912819 CAAGAAAGTATGCATTATGTGGG - Intronic
964077594 3:152710552-152710574 AAAGACATTGTGCTGTTTGTGGG - Intergenic
965074507 3:163959484-163959506 CAAGACAGTGCATAGTCTGTTGG - Intergenic
970993178 4:22236376-22236398 GAACACAGTGTGAAGTCTCTAGG - Intergenic
971365723 4:25975573-25975595 CAGGACATTGTGCAGCCTGCGGG + Intergenic
972786448 4:42330837-42330859 GACGAGAGTGAGCAGTCTGTGGG - Intergenic
973571877 4:52248643-52248665 TAAGAGATTTTGCAGTCTGTTGG - Intergenic
974328986 4:60451810-60451832 CATGAAAGTGTGTAGTCTTTAGG - Intergenic
974766087 4:66348546-66348568 CAAGACAGGATGTAGTCTGGTGG - Intergenic
975093547 4:70431346-70431368 CAAGACAATGTGCTCTGTGTTGG + Intronic
975668120 4:76754169-76754191 GAAGACAGTGTGCAGTTTCTGGG + Intronic
979190375 4:117849563-117849585 CAAGACAGTGCATAGTCTGTTGG - Intergenic
980825085 4:138063378-138063400 TAAGACAAGATGCAGTCTGTTGG - Intergenic
981713983 4:147734337-147734359 CAAGAAAGTCTACAGTCTGGAGG - Intronic
982191047 4:152855597-152855619 CAGGACAGTGTGAGATCTGTTGG + Intronic
984600586 4:181721802-181721824 CAAGACAGCGTGTAGCCTCTCGG + Intergenic
984741813 4:183172133-183172155 CAACACACTGTGTATTCTGTTGG + Intronic
985059809 4:186066323-186066345 AAAGATAGTGTATAGTCTGTAGG - Intergenic
986445626 5:7818774-7818796 CAAAACAGTGTAGAGTCTCTGGG - Intronic
991591604 5:68257255-68257277 CAAGACAGGGTGAAATGTGTGGG - Intronic
993891327 5:93478120-93478142 CATGGCTGTGTGCAGTCTGCAGG - Intergenic
997781833 5:136667296-136667318 CAGGACAACATGCAGTCTGTTGG - Intergenic
998383372 5:141741716-141741738 GAAGACATTCTGCAGTCTCTGGG + Intergenic
1000016483 5:157282286-157282308 CAAGAGAGTGGGCAGTGTGGGGG + Intronic
1001412237 5:171519881-171519903 CGAGGCAGTGTGCTGTTTGTGGG + Intergenic
1003011707 6:2433205-2433227 CAAGACAGTTTGCAGGATGAGGG - Intergenic
1003223887 6:4187726-4187748 CAAGACAGCTTTCAGTCTTTGGG + Intergenic
1006668971 6:35717865-35717887 CAAGACATTGTGCTTTCTGCTGG - Intronic
1009295366 6:61940661-61940683 CAGGACAGTGTGCAGTCCATTGG - Intronic
1010420734 6:75672108-75672130 AAAGACAGTCTGCAGTATGAGGG - Intronic
1011117196 6:83906335-83906357 TAGTACAGTGTGCAGTTTGTTGG + Intronic
1011546138 6:88483480-88483502 CAAGACAGTGTGAAGGCCCTGGG + Intergenic
1012366109 6:98443031-98443053 CTAGAGAGTGTGCATTCTGAAGG + Intergenic
1013127851 6:107202416-107202438 CAAAACAGTGTGTAGTGTATGGG + Intronic
1014803352 6:125801963-125801985 CAAGACATTGTGCATTGTCTTGG - Intronic
1015314705 6:131805626-131805648 AAACACAGTGTGCAGTCTCCAGG - Intergenic
1018270959 6:162077038-162077060 GAAGAGAGTGGGCAGGCTGTTGG + Intronic
1021587114 7:22221253-22221275 TAAGACAGTCTGTACTCTGTTGG + Intronic
1022635419 7:32129167-32129189 CAAGACTGTGTTTAATCTGTTGG + Intronic
1024311304 7:47971679-47971701 AAAGCCAGTGTGTAGTCTGCTGG + Intronic
1026208477 7:68280162-68280184 CAAGGCAGGATGCAGTCTGGTGG - Intergenic
1026406478 7:70071353-70071375 CATGAGGGTGTGCTGTCTGTTGG - Intronic
1027801652 7:82759808-82759830 CAAAGCATTGTGCAGGCTGTAGG + Intronic
1028341458 7:89725633-89725655 GGAGAGAGTGTGCAGACTGTGGG + Intergenic
1030811385 7:113976443-113976465 CAACCCAGTGTGAAATCTGTAGG - Intronic
1036107550 8:5857009-5857031 AAAGAGACTGTGCAGTCAGTAGG - Intergenic
1036238425 8:7062390-7062412 TAAGACAATGTGCTGTCTGTTGG + Intergenic
1036594386 8:10199238-10199260 CCAGACAGTCTGCAGTCTCAGGG + Intronic
1041991214 8:63994366-63994388 CAAGACAGTGTGTGGTCTTATGG + Intergenic
1043025452 8:75061770-75061792 CAAGACAAACTGGAGTCTGTTGG + Intergenic
1044876601 8:96673736-96673758 CAAGATAGGGTGCAATCTGAGGG + Intronic
1045124379 8:99073016-99073038 AAAGACAGTGTGATGCCTGTAGG + Intronic
1045848837 8:106669289-106669311 CAATACATTGTGGATTCTGTAGG + Intronic
1048159507 8:132001412-132001434 CAACACAGTGTTCAGTCAGTGGG + Intronic
1049661273 8:143820729-143820751 AAAGACAGAGTTCAGTCTGTTGG + Intronic
1049929210 9:439831-439853 CTAGCCACTGTGCAGTCTGAAGG + Intronic
1051108120 9:13603851-13603873 TAAGACAGCATGCAATCTGTTGG + Intergenic
1051608011 9:18935580-18935602 CAAGACTGTGTGCAGACTAAAGG - Intronic
1052260967 9:26515855-26515877 CAAGAGAGTGTGAGGTCTGAGGG + Intergenic
1058364278 9:104189132-104189154 AAAGAATGTGTGCAATCTGTAGG + Intergenic
1060988589 9:127835592-127835614 GAAGCCAGAGTGCAGTCTGGTGG + Intronic
1186175972 X:6926120-6926142 CAAGACAGGGTCCATTCAGTTGG + Intergenic
1189128049 X:38468779-38468801 CATGACAATGTGCTGTATGTGGG - Intronic
1189924868 X:45942239-45942261 CAAAATAGTTTGCAGTGTGTTGG + Intergenic
1190517919 X:51243800-51243822 CAGTATGGTGTGCAGTCTGTTGG + Intergenic
1195235228 X:102890313-102890335 GCAGACAGTGTGCAATCTGGTGG + Intergenic
1195944765 X:110198088-110198110 GAAGAAAGTGTGCAGTTTTTAGG - Exonic
1197442256 X:126506882-126506904 CAAGACAGTGTGAAATATTTCGG - Intergenic
1197643564 X:128993157-128993179 CAGGGCAGGGTGCAGTCTGGTGG + Intergenic
1198929505 X:141838526-141838548 CAAGACAGTGTGCAGTCTGTTGG + Intronic
1198965413 X:142223842-142223864 CAACACAGTGTCCAGTTTCTTGG + Intergenic