ID: 1198933025

View in Genome Browser
Species Human (GRCh38)
Location X:141880123-141880145
Sequence CACAGGGAGCTGCCTCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198933020_1198933025 7 Left 1198933020 X:141880093-141880115 CCTTGGTCTGAGGGTCCCGTGGC 0: 1
1: 1
2: 1
3: 12
4: 128
Right 1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG 0: 1
1: 0
2: 3
3: 19
4: 201
1198933023_1198933025 -8 Left 1198933023 X:141880108-141880130 CCCGTGGCAAATCAGCACAGGGA 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG 0: 1
1: 0
2: 3
3: 19
4: 201
1198933024_1198933025 -9 Left 1198933024 X:141880109-141880131 CCGTGGCAAATCAGCACAGGGAG 0: 1
1: 0
2: 2
3: 19
4: 252
Right 1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG 0: 1
1: 0
2: 3
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198933025 Original CRISPR CACAGGGAGCTGCCTCCAGT TGG Intronic
900130464 1:1085114-1085136 CTCAGGGCCCAGCCTCCAGTCGG - Intronic
900756659 1:4440130-4440152 CACATGGAGCTCTCTCCAATGGG - Intergenic
901406247 1:9048369-9048391 TACAGGCACCTGCCACCAGTGGG - Intronic
902252162 1:15161066-15161088 CACAGGCAGTTGCCTCCACCAGG - Intronic
902562546 1:17286815-17286837 CACTGGAAGCTGCCTCCATCAGG + Intergenic
902981882 1:20129288-20129310 CTCAGGGAGCCGCCTATAGTTGG + Intergenic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
905434825 1:37949071-37949093 CTCAGGCAGCTGCCTTCAGCTGG - Intergenic
906834984 1:49073735-49073757 GACAGGGTGCTTCCTCAAGTGGG - Intronic
907401588 1:54228039-54228061 TGCATGGAGCTGCCTCCAGAAGG + Intronic
908511734 1:64854935-64854957 CACAGGGGGCTGCCTGGAGGAGG - Intronic
911133929 1:94418858-94418880 CTCAGGCAGCGGCCTCCAGTTGG + Intronic
915524820 1:156469077-156469099 ATGAGGGAGCTGCCTCCAGGAGG + Intronic
915580891 1:156812672-156812694 CAGAGGCAGGTGCCTCCAGGAGG + Intronic
915637967 1:157199592-157199614 CAGAGGGAGGTGACTGCAGTGGG + Intergenic
916017772 1:160765187-160765209 CACTGGGCCCAGCCTCCAGTGGG + Intergenic
916405378 1:164492889-164492911 CCCAAGAAGCTGCCTCCTGTTGG + Intergenic
917492878 1:175513273-175513295 CTCAGAGAGCTGCCTCCATATGG - Intronic
919273371 1:195380307-195380329 CACAGTGAGCTGCTTCAAATTGG - Intergenic
919743757 1:200995895-200995917 CACTTGGTGCTGCCTCCTGTTGG - Intronic
919883091 1:201913740-201913762 CACAGGCAGCAGCCTCCATTTGG - Intronic
923886912 1:238167848-238167870 CAGATGGAACTGCCTCCAGGTGG + Intergenic
1064544529 10:16437252-16437274 CACAGGGAGCTGGCGCCACACGG - Intronic
1067099206 10:43322524-43322546 CAAAGGGAGCGGCCTTCAGGAGG + Intergenic
1067350934 10:45474913-45474935 CAGAGGGAGCTGCCTGGAGATGG + Intronic
1068657808 10:59592878-59592900 CACAGGGAGCTGCCTGAAGACGG + Intergenic
1068854323 10:61782052-61782074 CACAGCCAACTGCCTCCAGTGGG + Intergenic
1069771191 10:70901519-70901541 CTCAGGGAGCTGCCACCCCTGGG - Intergenic
1069797687 10:71063681-71063703 CACAGGGGCCGGCCTCCAGGAGG + Intergenic
1070280206 10:75043267-75043289 CTCAGGGAGCTGACTTGAGTGGG - Intronic
1071436842 10:85655290-85655312 CACAGGGACTTGGATCCAGTGGG - Intronic
1072663636 10:97379029-97379051 CACATGGAGCTGCCCCAACTGGG - Intronic
1074543413 10:114384740-114384762 CACAGGGCACAGCCCCCAGTAGG - Intronic
1075011045 10:118870482-118870504 GAGAGGGTGCTGCGTCCAGTGGG - Intergenic
1075632356 10:124008441-124008463 CACTGGGAGCAGCCGCCAGCAGG - Exonic
1075879936 10:125842310-125842332 CAGAGGGAGCTCCCTCAACTAGG + Intronic
1076010940 10:126987595-126987617 CACGTAGAGCTGCCTCCAGATGG - Exonic
1076030968 10:127157901-127157923 CACAGGCAGCTGCCAGCAGCTGG + Intronic
1077096613 11:801735-801757 CACAGGGAGCAGGATCCAGGAGG + Intronic
1077500151 11:2905879-2905901 CACTGGGAGCTTGGTCCAGTGGG + Intronic
1077530643 11:3093255-3093277 CACAGGGAGGTCCCTGCAGGCGG - Intronic
1078574294 11:12485513-12485535 CACTGGGAGCTCCCTCAGGTTGG - Intronic
1082082798 11:48025294-48025316 CAAAGGGAGCAGCTGCCAGTCGG + Intronic
1085347327 11:75776649-75776671 CACAGGAAGCTGTCTCCACTTGG - Intronic
1086370544 11:86151714-86151736 CACAGGAAGCTGCCTGAAGCTGG - Intergenic
1086605532 11:88691900-88691922 CACAGGGAGCTGCTTCAAAGGGG - Intronic
1094498156 12:31002128-31002150 CTCAGGGACCTTGCTCCAGTGGG + Intergenic
1096521315 12:52186258-52186280 CACAGAGAGCTTCCTGCAGGAGG - Intronic
1097537374 12:60889240-60889262 CACATGGAGCTGTTTCCAGGGGG + Intergenic
1102193115 12:111004269-111004291 CACAGGGAGCTGTTTCCATGTGG + Intergenic
1102694724 12:114789866-114789888 CTCAAGGAGCTGCCTCCAGTGGG - Intergenic
1102788530 12:115624040-115624062 CCCAGGGGGCTGCCTCCAGAAGG + Intergenic
1105023581 12:132834170-132834192 CAAAGAGAGCTGTTTCCAGTGGG - Intronic
1106031691 13:26010613-26010635 CACAGGGAGCTGTGGACAGTCGG + Intronic
1108646251 13:52431930-52431952 CAGTGGGAGCTGCTTCAAGTTGG - Intronic
1110032337 13:70631531-70631553 CAGAGGGAGCTGAGTGCAGTGGG - Intergenic
1113283784 13:108822418-108822440 AAGAAGCAGCTGCCTCCAGTAGG + Intronic
1113704166 13:112415188-112415210 CACACTGAGCTGCCTGGAGTTGG + Intronic
1113814880 13:113162999-113163021 CACGGGGAGCCGCCTGCAGGAGG - Exonic
1115354490 14:32433037-32433059 TACAGGGAGCTGACTCAATTAGG - Intronic
1116712211 14:48383135-48383157 CACAGGGAGTTTGCTCCTGTTGG - Intergenic
1120190418 14:81435624-81435646 CTCAGGCAGCTCCTTCCAGTAGG + Intronic
1121114131 14:91331681-91331703 AACAGGGAGCTGCCCCAAGGAGG - Intronic
1122231645 14:100309052-100309074 GACAGGGGGCTGCCTTCAGCTGG + Intergenic
1122318337 14:100838671-100838693 CCTAGGGGGCTGCCTCTAGTGGG + Intergenic
1122719343 14:103713444-103713466 CACAGGGAGCAGCCCACAGCAGG + Intronic
1122879193 14:104682444-104682466 AGCAGGCAGCTGCCTGCAGTGGG + Intergenic
1122898836 14:104773754-104773776 CCCAGGCAGCTGCCTGCTGTGGG - Intronic
1127551012 15:60038328-60038350 CCCAGGTGGCTGCCTCCAGAGGG + Intronic
1127899455 15:63330211-63330233 CACTGGAAGCTCCCTCCAGGTGG - Intronic
1128649249 15:69398519-69398541 CACAGGACGCTGCCTCTAGGAGG - Intronic
1128742447 15:70093289-70093311 CACTGGGGGCTCCCTCCAGGAGG + Intronic
1128757931 15:70195972-70195994 CAGTGGGAGCTGCGTCCAGCTGG - Intergenic
1129832953 15:78682455-78682477 CCCAGGGAGGTGCCTGCAGGAGG + Intronic
1131472486 15:92709097-92709119 CACTGGGAGCTTCCTGAAGTGGG - Intronic
1132238121 15:100237216-100237238 CACATGGAGTCGCCTCCTGTAGG - Intronic
1132299158 15:100765883-100765905 CCAAGGGAGCTGGCTTCAGTGGG + Intergenic
1132603559 16:784399-784421 CGGTGGCAGCTGCCTCCAGTCGG + Intergenic
1132706221 16:1244564-1244586 CACAGGGCGATGTCACCAGTGGG - Intergenic
1132801738 16:1757989-1758011 GAGAGGGAGCAGCCTCCAGCAGG - Intronic
1132897239 16:2234854-2234876 CACAGGGGGCTGCCTGCTGGAGG + Exonic
1135097906 16:19579707-19579729 CTCAGGGAGGTGACTGCAGTTGG - Intronic
1135646572 16:24167743-24167765 CTCATGATGCTGCCTCCAGTGGG - Intronic
1136578655 16:31139220-31139242 CAGAGATTGCTGCCTCCAGTGGG + Exonic
1139914239 16:70418443-70418465 CAGAGGGAAAAGCCTCCAGTTGG - Intronic
1141046876 16:80723274-80723296 CACAGGGAGCTGTGCCCAGAAGG + Intronic
1141650991 16:85393084-85393106 CACAGGCAGCTGCCTCTTGGAGG + Intergenic
1142229132 16:88891446-88891468 CCCAGGGTGCTGGCTCCAGGAGG + Intronic
1142411154 16:89917925-89917947 CCCAGGAAGATGCCTGCAGTGGG + Exonic
1142561566 17:812338-812360 CAAAGGGAGCCGCCTCCACCTGG - Intronic
1144443658 17:15306865-15306887 AGCAGAGAGGTGCCTCCAGTTGG + Intronic
1148339800 17:46866663-46866685 CCCAGGCAGCTGCCTGTAGTTGG + Intronic
1148759094 17:49990209-49990231 CACAGGGAGATCCGTCCAGGAGG + Exonic
1148783649 17:50134929-50134951 GGCAGGGAGCAGCCCCCAGTTGG + Exonic
1150011742 17:61511115-61511137 TCTAGGAAGCTGCCTCCAGTTGG + Intergenic
1150314843 17:64159993-64160015 CACAAGGAGCTACCTCCATGGGG - Intronic
1151065115 17:71139805-71139827 CATTGGGAGCTCCCTCCAGTTGG - Intergenic
1151527504 17:74681071-74681093 CCCAAGGAGCTGCGTCCAGCAGG + Intronic
1152377854 17:79927977-79927999 CACAGGGAGCTGTCACCACATGG - Intergenic
1152694190 17:81735445-81735467 CACAGGGAACTCCCCCCAGGAGG - Intergenic
1154165047 18:12008570-12008592 CACAGGGACCAGCCTGCAGAAGG + Intronic
1154490245 18:14916474-14916496 GAGAGGGAGATGCCTCCAGCTGG + Intergenic
1156260363 18:35440334-35440356 CACAGGCTGTTGCCTCCACTGGG + Intergenic
1156502951 18:37571200-37571222 CACAGCGTTCTCCCTCCAGTGGG - Intergenic
1158293515 18:55968832-55968854 CACAGGGAGCTCACTCCTGCAGG - Intergenic
1160080566 18:75723163-75723185 ATCAGGGAGGTGCTTCCAGTAGG - Intergenic
1160106461 18:75982781-75982803 CACAGGGAGTTGCCTTGATTGGG - Intergenic
1161736289 19:5994257-5994279 CACAGGGCGCTGCGCCCAGCTGG + Exonic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163816276 19:19466448-19466470 CACAGGGAGAAGACTCCAGTGGG - Intronic
1164649745 19:29883108-29883130 CACAGAGAGATGGCTCCCGTGGG - Intergenic
1166219222 19:41354123-41354145 AACAGGGTGCTGCCTCCTGGCGG + Intronic
1167660179 19:50791753-50791775 CACCGGGATCGGCCTCCAGCGGG - Exonic
1168349684 19:55668894-55668916 CACAGGGCACTGCCTCAGGTTGG - Intronic
925948748 2:8891493-8891515 CACAGGGAGGTAACTGCAGTGGG + Intronic
927148012 2:20179681-20179703 CACAGAGAGCAGCCTGCAGTGGG - Intergenic
929294216 2:40228439-40228461 CAGCTGCAGCTGCCTCCAGTTGG - Intronic
929608432 2:43251626-43251648 CACAGGGAGCTGTGTCCAGCTGG + Intronic
930114978 2:47710656-47710678 GGAAGGGAGCTGCCTCCAGAGGG + Intronic
931199423 2:60083092-60083114 CACAGGGAGCTCTTTCAAGTTGG - Intergenic
931704873 2:64939012-64939034 CACAGGGAGCTGAAGCAAGTGGG + Intergenic
932447106 2:71787774-71787796 CACAGGGAGATGTCTGCAGGAGG + Intergenic
937194121 2:120134574-120134596 CTCAGTGAGCTGCATGCAGTTGG - Intronic
937454739 2:122031652-122031674 CGCAGGGAGCTGCATCCAGTAGG + Intergenic
938392047 2:130914486-130914508 CACAGGGTGCTGCTTACAGAGGG + Intronic
940046636 2:149416730-149416752 CACGGGGTGCTGTCTCCAATAGG - Intronic
941023039 2:160430134-160430156 CTCAGGCAGCTGCATGCAGTTGG - Intronic
941157644 2:161999007-161999029 CACTGGGAGAAGCCTCCAGAGGG + Intronic
945866606 2:215182822-215182844 CATAGGGGGCTGCCTGCAGATGG - Intergenic
946426605 2:219601751-219601773 CCCAAGGGGCTGCCTCAAGTTGG - Intronic
948305525 2:236944402-236944424 TACAGGGCCCTGGCTCCAGTGGG + Intergenic
948329534 2:237154257-237154279 CACAGGGAGGTGGCTGCAGGTGG + Intergenic
948452403 2:238084253-238084275 CACAGGGAGCGTCCTCCCATTGG + Intronic
1169197888 20:3693161-3693183 CACAGGCAGCAGCCTGCAGGAGG + Intronic
1170713402 20:18811803-18811825 CATAGGGAGCTTCATCAAGTTGG - Intronic
1171209991 20:23309552-23309574 TACAGGGTGCTGGCTCCAGCTGG - Intergenic
1172432964 20:34907812-34907834 CACAGGGAGCTTACTAAAGTGGG - Intronic
1172590463 20:36114019-36114041 CACAGGCAGCTGGGTGCAGTCGG + Intronic
1173360543 20:42340535-42340557 CTCAGGGAGTTGCCTCCACTTGG - Intronic
1175523970 20:59621030-59621052 CACTGGGAGCTCCTTCGAGTCGG + Intronic
1175785654 20:61710243-61710265 CACAGGCAGCTGCCAGCAGAGGG - Intronic
1176027328 20:62992756-62992778 CACAGGCAGCAGTCTCCAGGTGG + Intergenic
1180974898 22:19842893-19842915 GACAGGGAGCTGGCTGCAGTGGG - Intronic
1182053568 22:27331775-27331797 CCCAGGAAGCTGACTTCAGTGGG - Intergenic
1182434944 22:30324568-30324590 CAAAGGGAGGTGCTTCCACTGGG + Intronic
1183701418 22:39453336-39453358 CAGAGTGAGCTGGCTCCGGTCGG - Intergenic
1184433840 22:44458234-44458256 CACAGGGAGATGCTCCCAGTGGG - Intergenic
1184717736 22:46291408-46291430 CACAGGGAGCCGACTGCATTAGG + Intronic
1185066149 22:48632642-48632664 CACAGAGAACGGCCTCCAGAGGG - Intronic
949743133 3:7259445-7259467 CACTGGGACCTACCTCCACTGGG - Intronic
950041733 3:9924049-9924071 CACAGGCATCGGCCTACAGTGGG - Intronic
951710014 3:25577632-25577654 ACCCAGGAGCTGCCTCCAGTGGG + Intronic
953126249 3:40094164-40094186 CAGAGGGAGCTAAATCCAGTGGG - Intronic
953181385 3:40598036-40598058 GACAGAGAGCTGCATCCATTGGG + Intergenic
953201266 3:40780518-40780540 CACAGGAAACTGCCTCGAGGTGG - Intergenic
953798164 3:46001408-46001430 GTCAGGCAGCTGCCACCAGTTGG + Intergenic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
954697458 3:52435373-52435395 CAGAGGGTGCTGGCTCCAGCTGG + Exonic
954787243 3:53102850-53102872 CACAGGGCGTTGCCTCAAGGAGG - Intronic
955491618 3:59488736-59488758 CAAATGGAGCTTACTCCAGTTGG - Intergenic
959252230 3:103963768-103963790 CACAGGGAGCTGCCTAGAGATGG + Intergenic
962853343 3:139324272-139324294 CTCGGGGAGCTGTTTCCAGTTGG + Intronic
967327040 3:188251228-188251250 CAGTGGGAGCTGCATCAAGTTGG + Intronic
969292643 4:6250582-6250604 CACAGGGAAGCGCCTCCTGTGGG + Intergenic
977191179 4:94002777-94002799 CACAGGGTTCTGTCTTCAGTGGG - Intergenic
982136323 4:152277313-152277335 CACCGGCAGCTGCCTGCTGTGGG - Intergenic
983010392 4:162538689-162538711 CACAGGGATGTTCCTTCAGTTGG + Intergenic
985851805 5:2393798-2393820 CACAGCGAGCTGCTTGCAGAGGG - Intergenic
986331570 5:6720146-6720168 AACAGGGGGCTTCCTCCAGCTGG - Intronic
986361068 5:6978669-6978691 GACCGGGGGCTGCCTGCAGTTGG + Intergenic
986456344 5:7924422-7924444 CACAGGAAGCTGCCAGCAATGGG - Intergenic
990729966 5:58797517-58797539 CAACTGGAGCTGCCTCCCGTTGG + Intronic
991069934 5:62465830-62465852 CACAGGAAGCTGGCACCTGTAGG - Intronic
992792551 5:80226571-80226593 CACAAGGGGCAGCATCCAGTGGG - Intronic
993435688 5:87890429-87890451 CAGTGGGAGCTGCTTCAAGTAGG - Intergenic
998480747 5:142460631-142460653 CTCAGGGCTCTGCCCCCAGTGGG + Intergenic
999245255 5:150150758-150150780 CACAGGGACCTACCTCTGGTGGG - Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1001529400 5:172451811-172451833 CACAGGGATCTGTTTCCATTGGG + Intronic
1002097660 5:176840904-176840926 CACAGAGAGCTGCTGGCAGTGGG + Intronic
1002154719 5:177267555-177267577 CACAGAAGGCTGCCTCCTGTGGG - Exonic
1008865493 6:56204680-56204702 GACTGGGAGATACCTCCAGTAGG + Intronic
1010196734 6:73247477-73247499 CCCAGGGAGCAGCCTCAGGTTGG - Intronic
1015185134 6:130407386-130407408 CACAAGGAGCTTGCTACAGTAGG + Intronic
1017028206 6:150198887-150198909 CACAGTGCCCTGCCTGCAGTAGG + Intronic
1019455323 7:1123799-1123821 CGGAGGGAGCTGCCTTCAGCTGG - Intronic
1021939421 7:25665108-25665130 CACAGGCAGTTGCCTCTGGTAGG - Intergenic
1021948850 7:25754445-25754467 TACAGGGAGCTGCTTCCAAATGG + Intergenic
1022204409 7:28149572-28149594 AATAGGGAGGTGCATCCAGTTGG + Intronic
1022509406 7:30925707-30925729 CACAGGGTCCTGCCCCTAGTAGG + Intergenic
1023223102 7:37941055-37941077 CAGAGGGAGCTCCTTCAAGTTGG - Intronic
1023352427 7:39333833-39333855 TACAGGGAGCTGCAGCAAGTGGG - Intronic
1024627075 7:51217012-51217034 AGCTGTGAGCTGCCTCCAGTGGG - Intronic
1026947189 7:74324348-74324370 CACAGGGAGGTGCTTCCCATAGG - Intronic
1032791941 7:135248798-135248820 CACTGGGAGTTCCCTCCAATAGG - Intronic
1035019783 7:155794068-155794090 CCAGGGGAGCTTCCTCCAGTGGG - Intergenic
1035654075 8:1292390-1292412 CAGGGAGAGCTGCCTCCAGTTGG + Intergenic
1035911461 8:3571587-3571609 CCCCTGCAGCTGCCTCCAGTAGG - Intronic
1036280456 8:7395922-7395944 CACAGGGACCTGCCCTCAGAAGG + Intergenic
1036703850 8:11031941-11031963 CACAGGGAGATCCCCCCAGCAGG + Intronic
1037634958 8:20693316-20693338 CAGAGGGATCTGCATCCAGCAGG - Intergenic
1037802963 8:22044976-22044998 CACAGGCAGCGGCATCCAGGTGG + Intronic
1039136919 8:34335385-34335407 CATAGGGACCTGCCTCTAGGTGG + Intergenic
1041821773 8:62044072-62044094 CAACGGTAGCTCCCTCCAGTTGG + Intergenic
1048080268 8:131119178-131119200 CACAAGAAGCTGGCTTCAGTTGG + Intergenic
1048979565 8:139695904-139695926 CCCAGGGAGCTGGCCCCAGAGGG - Intronic
1049554221 8:143274183-143274205 CAGAGGCAGCTGCTTCCAGCAGG - Intronic
1049807197 8:144546449-144546471 CACAGGGAGCTTCCTTGGGTGGG - Intronic
1049867849 8:144950568-144950590 CTCTGGGGGCTGCCTCCGGTAGG - Intronic
1053208761 9:36209859-36209881 CAGAGGGGGTTGTCTCCAGTGGG + Intronic
1053503769 9:38622368-38622390 CACAAGGAGCTGCATCCAGCAGG - Intergenic
1059467398 9:114477690-114477712 CTCAGGGTGCAGCCTGCAGTAGG - Intronic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1060544058 9:124450293-124450315 GACAGAGACCTGCCTCCAGGTGG - Intergenic
1062077866 9:134601829-134601851 CCCAGCGAGCTGCCTGCAGTGGG + Intergenic
1062461639 9:136664852-136664874 CACAGGGCGCTGGCTCCGGCTGG + Intronic
1189373651 X:40449418-40449440 CTCAGGGAGCCGGCTCCAGGCGG - Intergenic
1190247554 X:48700493-48700515 CCCGGGCAGCAGCCTCCAGTGGG - Exonic
1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG + Intronic
1198935010 X:141895796-141895818 CAGGGAGAGTTGCCTCCAGTTGG + Intronic
1198936226 X:141904355-141904377 CATGGGGAGCTGCCTCCAGTTGG + Intronic
1198963352 X:142204820-142204842 CACGGGGAGCTGCCTCTGGTTGG - Intronic
1199744986 X:150766859-150766881 CACTAGGAGCTGCCACCGGTGGG + Exonic
1199755736 X:150863292-150863314 CATAGGGAGGGGCTTCCAGTAGG + Intronic