ID: 1198934038

View in Genome Browser
Species Human (GRCh38)
Location X:141887847-141887869
Sequence TGTTATCTGCAGAAGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 7, 3: 245, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198934038_1198934041 15 Left 1198934038 X:141887847-141887869 CCTTCAATCTTCTGCAGATAACA 0: 1
1: 0
2: 7
3: 245
4: 392
Right 1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1198934038_1198934039 4 Left 1198934038 X:141887847-141887869 CCTTCAATCTTCTGCAGATAACA 0: 1
1: 0
2: 7
3: 245
4: 392
Right 1198934039 X:141887874-141887896 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1198934038_1198934043 25 Left 1198934038 X:141887847-141887869 CCTTCAATCTTCTGCAGATAACA 0: 1
1: 0
2: 7
3: 245
4: 392
Right 1198934043 X:141887895-141887917 GGCCTGTTACTGGGCTTTCATGG 0: 1
1: 14
2: 170
3: 169
4: 217
1198934038_1198934042 16 Left 1198934038 X:141887847-141887869 CCTTCAATCTTCTGCAGATAACA 0: 1
1: 0
2: 7
3: 245
4: 392
Right 1198934042 X:141887886-141887908 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198934038 Original CRISPR TGTTATCTGCAGAAGATTGA AGG (reversed) Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901414634 1:9108222-9108244 GGTTAGTTGCAGAAGATTGGGGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903507186 1:23845850-23845872 TGTTATCTGCAGAAAACAAAAGG + Exonic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904452881 1:30627690-30627712 TGTTATCTACAGAACAGTGCAGG + Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908418609 1:63937471-63937493 TGACATCTGCAGAAGTTAGAAGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910163650 1:84299598-84299620 TTTTATCAGCAGAGGATTGATGG + Intronic
910178575 1:84457386-84457408 TTTTATCTGCTGAAAATTGCTGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911735489 1:101332166-101332188 TGATTTCTGCAGAAGACAGAAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
913965362 1:143372645-143372667 TTTCAACTACAGAAGATTGATGG + Intergenic
914059738 1:144198247-144198269 TTTCAACTACAGAAGATTGATGG + Intergenic
914119412 1:144768124-144768146 TTTCAACTACAGAAGATTGATGG - Intergenic
914419743 1:147518486-147518508 TGGTAGCTTCAGAAGATTCATGG - Intergenic
916002243 1:160628238-160628260 AGTTCTCTGCTGAAGATTGAAGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917260439 1:173161249-173161271 TGTGATTTGATGAAGATTGAAGG + Intergenic
917604074 1:176608010-176608032 GGATATCTGAACAAGATTGATGG + Intronic
918723721 1:187890093-187890115 TATTATCTGTAGAATTTTGAAGG + Intergenic
918748061 1:188231763-188231785 TGTTATCTGCAGATGCTGGAAGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920694018 1:208167986-208168008 TGCTATATGCAGCAGCTTGATGG + Intronic
922421341 1:225462800-225462822 TGTTATCTATAGAACAGTGACGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
922958830 1:229626879-229626901 TGTTCTCTGCAGTAGAGTGAAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923737664 1:236626740-236626762 TGTTCTCTGCATCATATTGAAGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066078960 10:31910355-31910377 TGTTATCCTCAGGAGAATGATGG - Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067575666 10:47406774-47406796 TGTTGTCTGCAGAAGAAGCAAGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069108785 10:64417320-64417342 TGTCATTTGCAGCAGAGTGAAGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073075354 10:100822440-100822462 TGTTAAGTGCAATAGATTGATGG + Intronic
1073084668 10:100880396-100880418 TGTTATTTGCAGAACAGGGATGG - Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1076231254 10:128821658-128821680 TGCCATCTGCAGAAGAATGTTGG + Intergenic
1076592590 10:131596268-131596290 AGCCATATGCAGAAGATTGAAGG + Intergenic
1076592910 10:131600969-131600991 AGCCATATGCAGAAGATTGAAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076944063 10:133631956-133631978 TGTTTTATGTAGAAGAATGAGGG - Intergenic
1077846950 11:6035760-6035782 TGTTATGTTCAGAAGATGGTGGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081714426 11:45238440-45238462 TGTTTTATGCACAAGATAGAAGG + Intergenic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1085945095 11:81260331-81260353 TGAGATCCGCAAAAGATTGAGGG - Intergenic
1087493116 11:98852690-98852712 TGTTCTCTACAGCAGAGTGACGG + Intergenic
1087863129 11:103188976-103188998 TGTTATCTTCATAAATTTGATGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090589153 11:128246749-128246771 TTTTATCTGCAGGAGACTGTAGG + Intergenic
1091113431 11:132992850-132992872 TGTTACCAGCAGAAGATTATTGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094816628 12:34193063-34193085 TGTTATATGCAGAGTATTGAAGG + Intergenic
1095294590 12:40513686-40513708 TGTTACCTGGAGAATATTTAAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098465075 12:70777642-70777664 TGTTAACTGCGTAAGACTGAAGG - Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101342040 12:103850793-103850815 AGATAACTGCAAAAGATTGAGGG + Intergenic
1101365949 12:104070655-104070677 TTTTACCTGCATTAGATTGATGG + Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101863363 12:108500526-108500548 TGGGATCTGCAGAACATTTAGGG + Intergenic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106634204 13:31509590-31509612 TGTTATCTGCAAAAGATGCTTGG - Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108458899 13:50645285-50645307 TGTTGTCTGCGGAAAATTGTGGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110046944 13:70842837-70842859 AGGTCTCTGCAGAGGATTGAAGG - Intergenic
1110810171 13:79803911-79803933 TTTTACCTGGAGAAGGTTGAGGG - Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111808372 13:93066604-93066626 TGTTATCTGCAAAACAGTTATGG + Intergenic
1112157150 13:96830755-96830777 TGTTCTTTTCAGAATATTGAGGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112871267 13:103973548-103973570 TGATTTCTGCAGAACATTGAAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113865348 13:113518566-113518588 TGTTATCTGCGGAAGATGTGGGG + Intronic
1114036079 14:18628898-18628920 TGCTATATGCCGAAGTTTGACGG + Intergenic
1114122559 14:19686133-19686155 TGCTATATGCCGAAGTTTGACGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114793668 14:25687342-25687364 TTTTCTCTGCAGTAGATTGAAGG - Intergenic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115298879 14:31861593-31861615 TGTTGTCTGCAGATGCTTCAAGG + Intergenic
1115941816 14:38618409-38618431 TGTTCTCTGCATAAGAATGGGGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117639510 14:57783542-57783564 TGCTAACTCCAGAAGTTTGAAGG + Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119521733 14:75291329-75291351 TGTTCTGTTCAGAAGATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1122356834 14:101127880-101127902 TGTTATTTCCAGAACATTCATGG + Intergenic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126209077 15:46079430-46079452 AGTTATTTGGAGAAGATTTAGGG - Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1128702378 15:69813848-69813870 TGTTATCTGCAAAATATGGGGGG + Intergenic
1129038356 15:72664565-72664587 TGTTAGCAGCATAGGATTGAGGG + Intronic
1129211534 15:74072666-74072688 TGTTAGCAGCATAGGATTGAGGG - Intronic
1129398870 15:75268418-75268440 TGTTAGCAGCATAGGATTGAGGG + Intronic
1129402478 15:75292694-75292716 TGTTAGCAGCATAGGATTGAGGG + Intronic
1129476016 15:75785122-75785144 TGTTAGCAGCATAGGATTGAGGG + Intergenic
1129728652 15:77916941-77916963 TGTTAGCAGCATAGGATTGAGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133675297 16:8065414-8065436 TGTTAGCTGTAGAGGAGTGAAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139127030 16:64090410-64090432 TGTTATCCTCATTAGATTGAAGG + Intergenic
1139136864 16:64215326-64215348 TGTGATCTGTACAAGATTGGTGG + Intergenic
1139975223 16:70804652-70804674 TGTTATCTCCAGAGCATTGAGGG + Intergenic
1140312463 16:73862872-73862894 AGTTATCTCCAGAAGATTCGTGG + Intergenic
1141525722 16:84610059-84610081 TGTTGTCTTCAGATGTTTGAGGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1145944626 17:28763993-28764015 TGTTATCTGAAGATGGTTTAAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149895382 17:60424907-60424929 TGTTATCTGCAGAGCAGTTAAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153300876 18:3591060-3591082 ACTAATCTGCAGCAGATTGAGGG + Intronic
1153517672 18:5919425-5919447 TTTCATCTGCAGAATATTGAAGG - Intergenic
1153592463 18:6688042-6688064 TGTTATCTTCAGGAGTTTTATGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156037950 18:32786922-32786944 TGTTATCTGCAGTTGTTAGAGGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1162486276 19:10962293-10962315 AGTTATCTGCTGAACAATGAGGG - Intronic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165214621 19:34261698-34261720 TTTGAGCTGCAGGAGATTGAGGG + Intronic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202699141 1_KI270712v1_random:150133-150155 TTTCAACTACAGAAGATTGATGG + Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
926473206 2:13287829-13287851 TGGTATGTGCATAAGTTTGAAGG - Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928433789 2:31240668-31240690 TGTTCTCAGCAGATGAGTGAAGG - Intronic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
930177147 2:48313404-48313426 TGATAGCTGCAGAAGAATTATGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933346995 2:81100365-81100387 TGTTATATCCAGAAGATCAAAGG - Intergenic
933524131 2:83415029-83415051 TGTATTCTGCAAAAAATTGATGG + Intergenic
933769060 2:85731626-85731648 TGTTGTCTCCAGAACATTCAGGG + Intergenic
934170091 2:89533618-89533640 TTTCAACTACAGAAGATTGATGG + Intergenic
934280392 2:91607926-91607948 TTTCAACTACAGAAGATTGATGG + Intergenic
935004965 2:99065028-99065050 TGTTATCTGCCTCTGATTGACGG + Exonic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937626703 2:124052156-124052178 TGTTATCTGCAGACCAGTGTGGG - Intronic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938274311 2:130004052-130004074 TGCTATATGCCGAAGTTTGACGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941268456 2:163394185-163394207 TTTAATCTGAAGAAGATTTAAGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945185878 2:207139128-207139150 TGTTTTCTAGAGAAGATGGATGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946835965 2:223772698-223772720 TATTATCTGCTGAAGACAGACGG - Intronic
947025426 2:225732741-225732763 TGTTATGTCCATAAGAGTGAAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1171822628 20:29868081-29868103 TGTTATGTGCTGAGTATTGAAGG + Intergenic
1171897214 20:30818894-30818916 AGCCATATGCAGAAGATTGAAGG - Intergenic
1171897493 20:30822232-30822254 TGTTATGTGCTGAGCATTGAAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177409502 21:20711349-20711371 TGTTATCTGAAGGAGATAGTAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177879272 21:26672819-26672841 TGTTATGTACAGAAGAGAGATGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179827873 21:43978022-43978044 TGTTTTATGAAGAAGATTCAAGG - Intronic
1180460205 22:15555960-15555982 TGCTATATGCCGAAGTTTGACGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184948586 22:47822536-47822558 TGGTATTTGCAGAATATTAAGGG + Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951229194 3:20157293-20157315 TGTTAACAGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952665094 3:35894729-35894751 TGTTATCTGTAGGAGAATTAAGG - Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG + Intronic
955272688 3:57517332-57517354 TGCTAGATGCTGAAGATTGATGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957415526 3:79898136-79898158 TGTCTTCTGCAGCAGAATGAGGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957892021 3:86371957-86371979 TGTTACCTGCATAACAGTGAAGG + Intergenic
958123073 3:89318523-89318545 TATTATGTGCAAATGATTGAGGG - Intronic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959363772 3:105429610-105429632 TTTTCTCTGGAGAAGATTAAAGG - Intronic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
962936727 3:140088349-140088371 TGTGGTCTGCACAAGAATGAAGG - Intronic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963657535 3:148076239-148076261 TGTTAACTGCAGCAGATTCAAGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964086434 3:152824417-152824439 AGTTATCTGCTGAAGAGTTAGGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965703035 3:171477981-171478003 GGTTAGCTGCAGTAGTTTGAAGG - Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965708744 3:171535657-171535679 TGGTGTGTGCAGAAGATAGATGG - Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969029702 4:4202124-4202146 TTTCAACTACAGAAGATTGATGG - Intronic
970229647 4:13896491-13896513 TGTTATCTGAAGGAGATATAAGG - Intergenic
971048052 4:22828476-22828498 TGTTATGCCCAGAAGATGGAGGG + Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974536047 4:63177112-63177134 TGTTATATCCAAAGGATTGAAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975199462 4:71568876-71568898 TGTTCTATGAAGGAGATTGAGGG + Exonic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976368111 4:84253844-84253866 GGTGATCTACAGATGATTGATGG - Intergenic
976435973 4:85018625-85018647 TGTTTTTTTCAGAAGATTGTTGG + Intergenic
976698283 4:87941624-87941646 TGGTTTCTGCAGAAGATAAATGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977384833 4:96325665-96325687 TGGTATCTGCAGAAAACAGAGGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977821512 4:101477363-101477385 TGTCATCTTCAGTAGGTTGAAGG - Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978422346 4:108546300-108546322 TTTTTTCTTCAGAACATTGAAGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979504993 4:121485457-121485479 TGTTATCTGCACAAGAGGGTGGG + Intergenic
979733715 4:124055671-124055693 TGCTATCTTCAGAAGAATGAAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
980970419 4:139562055-139562077 AGTTATCTGGAGTAGAATGAAGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983464126 4:168065374-168065396 TGTTACCTGCAGTAGCTTGTAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985447418 4:190032413-190032435 TGTTTTATGTAGAAGAATGAGGG - Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987561775 5:19532906-19532928 AGACATCTGAAGAAGATTGAGGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
988953455 5:36289804-36289826 TTTTTTTTGCAGATGATTGATGG - Intronic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991028764 5:62060179-62060201 TGTTTTCTTCAGAACATTGCTGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991092720 5:62708610-62708632 TGTTATCTATAGAACATTTAAGG + Intergenic
991511062 5:67376563-67376585 TTTTATATGCAGGAGATTTATGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994666266 5:102709145-102709167 TGACCTCTGCAGAAGCTTGAAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003736153 6:8879725-8879747 TGTTGTTTGCAGAAAAATGATGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1005006177 6:21289620-21289642 TGTTTTATGCAGAAGCTTTAGGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007192586 6:40032182-40032204 GGTTATCTGCAGTATATTCATGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009310252 6:62141542-62141564 TGTTTACTGCAGTACATTGAAGG + Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011451171 6:87494017-87494039 TGTTATGTGCAAGAGATTGCTGG + Intronic
1011629112 6:89307698-89307720 TGTTGTGTGCAGCATATTGAAGG + Intronic
1011979381 6:93353535-93353557 CTTTATCTGCAGAAGCATGAGGG - Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014416983 6:121195361-121195383 GGTTATCTGCAGAAGATGGTAGG - Intronic
1014472665 6:121835470-121835492 TGTTATGTGAAGAAAGTTGAGGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016360496 6:143262309-143262331 TTTTTTCTCCAGAAAATTGAAGG + Intronic
1016606104 6:145929295-145929317 TGTTTTCTGCAGATGATTTTCGG - Intronic
1017036710 6:150273689-150273711 TGTTGTCTGGAGAAGGTTGTGGG - Intergenic
1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024482338 7:49877031-49877053 TGTAATCTGGAGGAGACTGACGG - Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027708719 7:81569708-81569730 TGTTCTCTGCAGAATACTGGAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028705092 7:93833159-93833181 TGTTATCTGCTGAGAATAGATGG - Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032256509 7:130301556-130301578 AGTTGTCTGCAGATGAATGAAGG - Intronic
1032647965 7:133846813-133846835 TGGTATCTGGACAAGATTGCTGG + Intronic
1032792808 7:135254813-135254835 GGCATTCTGCAGAAGATTGAGGG + Intronic
1032814858 7:135462927-135462949 AGCCATATGCAGAAGATTGAAGG - Intronic
1034082275 7:148290039-148290061 TGTTATATGCAGAATATAAAGGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037919461 8:22794707-22794729 TTTTATTTACAGAAGTTTGAAGG + Intronic
1039904636 8:41777215-41777237 TCTTATCTGCACAATATTGAAGG + Intronic
1040874512 8:52137072-52137094 TGTTATTTGCCCAGGATTGAGGG + Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1040975389 8:53188387-53188409 TGTTATCAGCAGAGGAATGATGG - Intergenic
1041565616 8:59274942-59274964 TTTTAAATGCAAAAGATTGAGGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042061093 8:64818840-64818862 TCTTAGCTGCAGAAATTTGAGGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043114687 8:76235565-76235587 TATTAGCTGCAGCAGTTTGAAGG - Intergenic
1043130787 8:76458193-76458215 TGTTACTTTTAGAAGATTGAAGG + Intergenic
1043962797 8:86436670-86436692 AGTCATCTGCAGAATATTTAAGG + Intronic
1044134514 8:88569586-88569608 TGTTATGTGTAGAAAATTAATGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044633268 8:94299306-94299328 TGGCATCTGCAGAAGACAGATGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045680311 8:104652338-104652360 TGTTCTGTGCAGACTATTGATGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048492882 8:134911172-134911194 TGTCATCCACAGAAGAGTGAGGG + Intergenic
1048787973 8:138071925-138071947 TGATATCTGAATAAGATTAATGG + Intergenic
1050477331 9:6053656-6053678 TCTTATCTGCTAAATATTGAGGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053596517 9:39567254-39567276 TTTTATTTGCAGAACATTTAAGG + Intergenic
1053750059 9:41244053-41244075 TGTTATGTGCTGAGCATTGAAGG - Intergenic
1053854482 9:42323894-42323916 TTTTATTTGCAGAACATTTAAGG + Intergenic
1054255557 9:62808391-62808413 TGTTATGTGCTGAGCATTGAAGG - Intergenic
1054335749 9:63807217-63807239 TGTTATGTGCTGAGCATTGAAGG + Intergenic
1054569741 9:66797764-66797786 TTTTATTTGCAGAACATTTAAGG - Intergenic
1054805483 9:69392825-69392847 AGTTTTCAGCAGAAGAGTGATGG + Intergenic
1055350332 9:75380013-75380035 TCTTATCTGCAGAAGTTCCACGG - Intergenic
1055820633 9:80258235-80258257 TGTAGTCTGAATAAGATTGAAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056106519 9:83352600-83352622 TGTCATCTTCAGATGATGGAAGG - Intronic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056490350 9:87100616-87100638 TGTAAGCTGTAGATGATTGACGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060976834 9:127770085-127770107 TGGGACCTGCAGAAGACTGAAGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203375690 Un_KI270442v1:374707-374729 TGTTATGTGCTGAGCATTGAAGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186479762 X:9887724-9887746 AGTTATCTGCACATGATAGAAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192349087 X:70340856-70340878 TTTGATCTGAAGAAGACTGAGGG - Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443439 X:93960190-93960212 TGTCCTGTGCAGAAGACTGAGGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1196121055 X:112051103-112051125 AGTTTTCTCCAGAAGACTGAAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196355774 X:114790387-114790409 TGTTATATGCATATGTTTGAAGG + Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197176617 X:123493075-123493097 TGTTGTCAGGAGAAGATTGAGGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197386776 X:125812275-125812297 AGATATCTGCAGTAGATTGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198219886 X:134589399-134589421 TTTCATGTGCAGAAGATTCAGGG + Intronic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199310540 X:146315321-146315343 TGGCCTCTGCAGAAGACTGATGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201066350 Y:10098940-10098962 TGTTATGTGCTGAGCATTGAAGG - Intergenic
1201691370 Y:16768947-16768969 TGTTACCCTAAGAAGATTGATGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic