ID: 1198934800

View in Genome Browser
Species Human (GRCh38)
Location X:141894984-141895006
Sequence GAGTGGGAGTGGTGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 577}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198934800 Original CRISPR GAGTGGGAGTGGTGGGAATA TGG Intronic
900971624 1:5995211-5995233 GAGGGGGACTGGCGGGAACATGG - Intronic
901903058 1:12383534-12383556 GAGTAGGAGTGGAGGGTGTATGG + Intronic
902276122 1:15340791-15340813 GAGTGGAAGAGGTATGAATATGG - Intronic
902479249 1:16702860-16702882 GGGTGGGGGTGGTGGGGGTATGG + Intergenic
902513168 1:16976940-16976962 AAGTGGAATTGGTGGGAGTAAGG + Intronic
902534536 1:17111932-17111954 GAGGGAGAGTGGTGGGAGCAGGG + Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
903992534 1:27283679-27283701 GAATGGTAGTGGTGGGGGTATGG + Intronic
905262238 1:36728108-36728130 GAGGGGAAGTGATGGGAAGAAGG - Intergenic
905933424 1:41805951-41805973 GGGAGGGAGTGGGGGGAATCAGG - Intronic
906287791 1:44598923-44598945 GGGTGAGAGAGGTGGGGATAGGG - Intronic
906333655 1:44909182-44909204 GGGTAGGAGTGGTGGTAGTAAGG + Intronic
906334885 1:44920517-44920539 GTGTGGGGGTGGTGGGAGTGGGG - Intronic
906343108 1:44998022-44998044 GAAGGGGAGTGGGGGGATTAAGG + Intergenic
906497596 1:46316442-46316464 GAAGGGGAGTGGTGAGAAGAGGG + Intronic
907082767 1:51639517-51639539 GAGTTGGGGTGGTGGGGACAAGG + Intronic
907574884 1:55517437-55517459 GACTGGGAGTGCTGGGAGCAGGG + Intergenic
908003121 1:59701110-59701132 CACTGGGAGTGCTGGGGATAGGG + Intronic
908342581 1:63197005-63197027 GAGTTGGAGTGATGGGAGGAAGG - Intergenic
908829293 1:68163555-68163577 GAGGGGGAGTGGTGGGGAGCTGG - Intronic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
909653875 1:78007910-78007932 GAGCTGGGATGGTGGGAATAAGG + Intronic
909708151 1:78611670-78611692 GAGTAGGAGTGGTGAGAAAAGGG - Intergenic
910936607 1:92487959-92487981 GAGTAGGAGAGAAGGGAATAAGG - Intergenic
912543658 1:110435487-110435509 CAGTGCTAGTGCTGGGAATATGG + Intergenic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
913377023 1:118163802-118163824 TAGTGGGAGTGTGGGGATTAAGG - Intronic
913446770 1:118958656-118958678 AGGTGGGGCTGGTGGGAATATGG - Intronic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914956216 1:152165028-152165050 AAGTGGGAGTGGAGGAAATGGGG + Intergenic
915289994 1:154877184-154877206 GGGTGGGAGTGGTGGGCAGGAGG - Intergenic
915508784 1:156374397-156374419 GAGTGGGGGAAGGGGGAATAGGG - Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915626713 1:157118391-157118413 AAGTGGCAGGGGTGGGACTATGG + Intergenic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
917490263 1:175492717-175492739 GTGTGGGAGTGTGGGGAATGGGG + Intronic
917623178 1:176818901-176818923 AATTGGGAGTGGTGGGGAGATGG - Intronic
917969345 1:180197098-180197120 GGGTGGGAGGGGAGGGAATGGGG - Exonic
918015886 1:180632175-180632197 GAGTGGGAGTGAGGGGGAAACGG + Exonic
920033432 1:203050620-203050642 GAGGGGCAGTGGTTGAAATAGGG + Intronic
920379301 1:205526541-205526563 GAGTGGGAGTAGTGGGATGAGGG + Intronic
920397549 1:205658234-205658256 GAGTGGAAGTGGGGGGAACCAGG + Exonic
920419984 1:205826484-205826506 CAGCGGGAGAGGTGTGAATAGGG + Intergenic
920867805 1:209767935-209767957 GATTGGGAGGGGTGAGAAGAAGG - Intronic
920948789 1:210553800-210553822 GAGAGGAAGAGGTGGGAAGAGGG - Intronic
921954250 1:220965780-220965802 GAGTGTGATTGGTGGTGATAAGG + Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
923438406 1:233992145-233992167 GGGTGGGATTGGTGGGCAAAGGG + Intronic
1063356087 10:5399718-5399740 GAGTGGGAGGGGTGGAGAAAAGG - Intronic
1063898321 10:10705494-10705516 GAGAGGGAGTGGTGGAAGTGTGG + Intergenic
1064390755 10:14940150-14940172 GAATGGGAGTGGTAGGGATGGGG - Intronic
1066746406 10:38606184-38606206 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1068119513 10:52771609-52771631 GAGAGGGAGTGATGGAAACAGGG + Exonic
1068459211 10:57304971-57304993 GAGAGTGAGTGGTGGGAGGAAGG - Intergenic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070567194 10:77612913-77612935 CAGTGGGGGTGGGGGGAGTAGGG - Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071702540 10:87955596-87955618 GAGAAGGAGTGGTGGGGAGAAGG + Intronic
1072578855 10:96722786-96722808 GAATGGGAGTGGCGGGGATAGGG + Intergenic
1072634448 10:97169048-97169070 GAGGAGGAGGGGTGGGACTAAGG - Intronic
1072766443 10:98098434-98098456 GAGTGAGAGTGGTGGGGTCATGG - Intergenic
1073438513 10:103537380-103537402 GAGTGCGAGAGGAGGGAGTAGGG - Intronic
1073515716 10:104074099-104074121 GAGATGAAGTGGTGGGAGTAGGG - Intronic
1074595557 10:114862352-114862374 GAGAGGGAGAGGGGGGAAAAAGG - Exonic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1075586247 10:123660373-123660395 GAATGGGAGTGATGGGCATTTGG + Intergenic
1075999873 10:126905787-126905809 GAGGGGGTGGGGTGGGAATGGGG + Intronic
1078221914 11:9358503-9358525 GATTCTGGGTGGTGGGAATATGG - Intergenic
1080649352 11:34209871-34209893 GAGGGGTAGTGGTAGGAGTAGGG + Intronic
1080678081 11:34446435-34446457 GAGTGGGAATGCTGGAATTATGG - Intronic
1081181646 11:39991977-39991999 GAGTTGGAGTGGCCAGAATATGG - Intergenic
1081656664 11:44862007-44862029 GAGTGGAGGTGGGGGGAAAAAGG - Intronic
1081718187 11:45266477-45266499 GAGAGGGAGTGGAAGGATTATGG - Intronic
1082914743 11:58420508-58420530 TGGTGGGAGTGGGGGAAATAGGG + Intergenic
1083273845 11:61586096-61586118 GTGAGGGTGAGGTGGGAATATGG - Intergenic
1083462723 11:62825247-62825269 GCGTAGGAGGGGTAGGAATATGG - Intronic
1084145953 11:67265543-67265565 GAGTAGGAGGGGTGGGATCAGGG + Intergenic
1084424151 11:69075432-69075454 CAGTGGGAGTTTGGGGAATAAGG + Intronic
1084963708 11:72732483-72732505 GAGGTGGAGCGGTGGGAACAGGG - Intronic
1085158928 11:74323149-74323171 GATTGGGAGTGGTTGGAAACTGG + Intergenic
1085290321 11:75394483-75394505 GAATTGAAGTCGTGGGAATAGGG - Intergenic
1085304061 11:75475295-75475317 GGGCGGGGGTGGTGAGAATAAGG + Intronic
1085411086 11:76291121-76291143 GAGTGGGAGTGGGAGGTATGGGG - Intergenic
1085505603 11:77056895-77056917 GGGTGGGGGTGGGGGGCATATGG - Intergenic
1085523843 11:77153237-77153259 GAGTGGGAGTGGTGTGAGGGAGG + Intronic
1085609600 11:77934505-77934527 GTGTTGGAGAGGTGGGATTACGG + Intronic
1085958407 11:81429343-81429365 GAGTGGGAGTGGTGGGGGGAAGG + Intergenic
1086575846 11:88338075-88338097 GAAAGGGTGTGGGGGGAATAAGG + Intergenic
1086932359 11:92706401-92706423 GTGTGGGAGCGGTGGGGATGTGG + Intronic
1086942281 11:92810646-92810668 GAGTGGGGGTGGGGGAGATAAGG + Intronic
1087601326 11:100319694-100319716 GATTGGGAGGGCTGGGACTAGGG - Intronic
1088087430 11:105997785-105997807 GATTGGGACTGGTGGGGAGAGGG + Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088737100 11:112736999-112737021 GAGGGAGAGAGCTGGGAATAAGG - Intergenic
1088807442 11:113365376-113365398 GAGTGGGAGGGAGGGGAAGAAGG - Intronic
1089046509 11:115505284-115505306 GAGCGGGGGTGGTGGGAGTTGGG + Intergenic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089418878 11:118316059-118316081 GAGGGGGGGTGGAGGGAGTAGGG - Exonic
1089454081 11:118615716-118615738 GAGAGGCAGTTGGGGGAATAAGG + Intronic
1089607776 11:119651647-119651669 CAGTGGGAGTGGGGGGATTGGGG - Intronic
1089615591 11:119692993-119693015 GAGTGGCAGGGGTGGGAGGATGG - Intronic
1090011387 11:123048626-123048648 GGAGGGGAGTGGTGGGAATCTGG + Intergenic
1090091917 11:123705515-123705537 GGGTGGGAGAGGTGGGCATGTGG - Intergenic
1091979690 12:4854966-4854988 AAGTGGGAGAGGTGAGGATAAGG + Intergenic
1092014785 12:5149559-5149581 GAGTGGGACGGGTGGGAGTAGGG + Intergenic
1092541143 12:9420394-9420416 GACTGGGAGTGGTGGGGATGAGG + Intergenic
1092927010 12:13280446-13280468 GAGGGGCAGAGGTGGGAAGAGGG - Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093829987 12:23744180-23744202 GAATGGGACTGGGGAGAATATGG - Intronic
1093894448 12:24561729-24561751 GAGGGGGAGTGGTAGGGAGAAGG + Intergenic
1094194744 12:27736258-27736280 GATTTGCAGTGGTGGGAAGAAGG + Intronic
1094511900 12:31102081-31102103 GACTGGGAGCGGTGGGGATGAGG - Intronic
1094725760 12:33114085-33114107 TCGAGGGAGTGGTGGGAAGAGGG + Intergenic
1095529029 12:43162661-43162683 GAGTGGGTGGGGTGGGGAAAGGG + Intergenic
1096039166 12:48499542-48499564 GAGTGGAAGTGGTGAGAAATGGG - Intergenic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096760088 12:53834321-53834343 GAGTGGTAGAGTTGGGAGTAGGG + Intergenic
1096765466 12:53885121-53885143 GGGTGGGAGTGGTGAGGAGAGGG + Intergenic
1097193248 12:57230294-57230316 GTGTGGGAGTGGTGGGGGTGGGG - Intronic
1097202671 12:57292880-57292902 GGGTGGGAGGGGTGGGGATTTGG - Intronic
1097515388 12:60598021-60598043 GAGGGAGAGTAGTGGGAATCTGG - Intergenic
1097560484 12:61199091-61199113 GCGTGGGAGGCGTGGGAATTAGG - Intergenic
1097942061 12:65321077-65321099 GACTGGGAGTGAAAGGAATAAGG - Intronic
1098071199 12:66676687-66676709 GTGTGGGAGTTGTGTGAGTAGGG + Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098323745 12:69278860-69278882 AAGTGAGAGTGGGGGGAATGGGG - Intergenic
1098612819 12:72482653-72482675 TAGTGGCAGTGGTGGTAGTATGG + Intronic
1099477899 12:83130113-83130135 GAGTGGGAAGAGTGGAAATAGGG - Intronic
1100224149 12:92539486-92539508 GATGGGGGGTGGGGGGAATATGG - Intergenic
1100690661 12:97035369-97035391 TAGTGGGAGTGGTAGAGATATGG + Intergenic
1100805282 12:98277041-98277063 AAGTGGCGGTGGTGGGATTAGGG - Intergenic
1101010208 12:100441566-100441588 GAGTGGAAGTGGTGAGAAATGGG + Intergenic
1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG + Intergenic
1102972260 12:117178581-117178603 GAGGGGGAGTGGCAGGAATTGGG - Intronic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1103364350 12:120370567-120370589 GATATGGAGAGGTGGGAATATGG - Intergenic
1103913860 12:124366061-124366083 GAGTGGCAGTGCTGGGTTTAGGG - Intronic
1104322304 12:127763033-127763055 GAGTGGGAGTGGGGGTATTTAGG + Intergenic
1105941595 13:25152764-25152786 GAGAGGGAGTGGTGAGGACAAGG - Intergenic
1105961279 13:25343165-25343187 GAGGGGAAGGGGTGGGAAGAGGG - Intronic
1106004619 13:25757113-25757135 GAGATGGAGTGGTGGGAGGAGGG + Intronic
1106208998 13:27623607-27623629 TAGTTGGAGTGGTGGGGGTAAGG + Intronic
1107445629 13:40468050-40468072 GAGTGGGGGTGGTAGGATGATGG - Intergenic
1107658718 13:42617199-42617221 GTGTTGGAGAGGTGGGATTACGG + Intergenic
1107668566 13:42718378-42718400 GAGTGGTAGTGGGGAGGATAGGG + Intergenic
1107793133 13:44022698-44022720 GAGTGGGAGTTGGGGGACTATGG + Intergenic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108779999 13:53818401-53818423 AAGTGGGCCAGGTGGGAATAAGG - Intergenic
1108820418 13:54342677-54342699 GCGGGGGAGTGGTGGGAGTGGGG - Intergenic
1109178459 13:59184645-59184667 GTTTGGGGGAGGTGGGAATAGGG - Intergenic
1109257567 13:60101794-60101816 GAGTGGGAGAAGTGGCAAGATGG - Intronic
1110065833 13:71104410-71104432 GGGTGGGAGTGGTGGGGGGAGGG - Intergenic
1110654142 13:77976655-77976677 GTCTGGGAGAGGTGGGAATGGGG - Intergenic
1111046785 13:82824054-82824076 CAGAAGAAGTGGTGGGAATAGGG + Intergenic
1111126209 13:83912832-83912854 GAAGGGGAGTCGTGGAAATAAGG + Intergenic
1111466245 13:88615009-88615031 GAGTTGGGGTGGCGGGAATGGGG + Intergenic
1111740418 13:92197878-92197900 GAGTGGTAGAGGTGGAAGTAGGG - Intronic
1111768258 13:92562342-92562364 GACTGAGAGTGGAGAGAATATGG - Intronic
1112524599 13:100132661-100132683 GAGTGGGATTGCTGGTCATATGG + Intronic
1112833193 13:103478827-103478849 TAGTGGGATTGTTGGGAAAAAGG + Intergenic
1113146413 13:107212952-107212974 GTGAGGGAGCGGTGGGAATGGGG - Intronic
1113662759 13:112118377-112118399 GAGTGGGAGGGGTGGGACCGAGG - Intergenic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114499888 14:23160863-23160885 TAGTGGGAGTGGAGGGAGTTAGG - Intronic
1115455019 14:33592101-33592123 GAGGGGGTGGGGTGTGAATAAGG - Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115933658 14:38527255-38527277 GGGTGGGAGAGGTGGGAAGGAGG + Intergenic
1117294215 14:54364402-54364424 GGGTGGCAGAGGTGGGGATAGGG - Intergenic
1117314542 14:54561002-54561024 GAGTGGGAGTGGCGTGAGAAAGG + Intergenic
1117796443 14:59399014-59399036 GAGGGGAAGTGGTGGGGACAAGG - Intergenic
1118648171 14:67860745-67860767 GAGTCTAAGTGGTGGGTATATGG + Intronic
1118748635 14:68791366-68791388 GATTGGGGGTGGTGGGGATGGGG + Intronic
1119535025 14:75395939-75395961 GAGGGGGAGTGGGGAGAAAAGGG + Intergenic
1119968440 14:78942966-78942988 GAGAGGGAGGGTTGGGAAAATGG + Intronic
1120143603 14:80955565-80955587 GAGCGGGAGGGGTGGGAAGAGGG - Exonic
1120153503 14:81064708-81064730 GATTGGGAGTTCTGGGTATATGG + Intronic
1120498769 14:85267993-85268015 GAATGAGAGTGAAGGGAATAAGG + Intergenic
1121102353 14:91258624-91258646 GAGTGGGAGTGCAGGGAACTTGG + Intergenic
1121176165 14:91892319-91892341 GATTGGGGGAGGTGGGGATAAGG - Intronic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1122431780 14:101655002-101655024 GAGGGGGAGAGATGGGAGTATGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123452709 15:20381080-20381102 GAGTGTGAGTGGTGTGACTGTGG + Intergenic
1123993319 15:25701034-25701056 GACTGGGAATGGTGGGAATCTGG + Intronic
1124034518 15:26042455-26042477 AGGTGGGTGTGGTGGGTATAGGG + Intergenic
1124100822 15:26691045-26691067 GGGAGGGAGAGGAGGGAATAAGG - Intronic
1124115094 15:26833943-26833965 GAGTGGGAGAGAGGGGAATTTGG - Intronic
1124143399 15:27097535-27097557 GATTGGGAGTGGTTGGAAAAAGG - Intronic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1125102135 15:35926463-35926485 GGGAGGCAGTGGTGGGAAGATGG + Intergenic
1125170260 15:36758983-36759005 GGGTGAGAGTGGTTGGGATAGGG + Intronic
1125404109 15:39335204-39335226 GAGGAAGAGTGGTGGGAATGAGG - Intergenic
1126378835 15:48025046-48025068 TACTGGTAGTGGTGGGAAGAGGG - Intergenic
1126382802 15:48066174-48066196 GAGTGGAAGTGTTGGAAACAAGG - Intergenic
1127065337 15:55231569-55231591 GAGTGAGGGGGATGGGAATAGGG - Intronic
1128170854 15:65511081-65511103 GAGTGGAAGTACTGGGAAAAAGG - Intronic
1128327202 15:66731743-66731765 GAGTAGGATTGCTGGGTATATGG + Intronic
1129256889 15:74338850-74338872 GAGTGGGAGTGGTGGTGAGAGGG - Intronic
1129299632 15:74618180-74618202 AAGTGTGAGTGTTGGGAAGAAGG + Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129599789 15:76992034-76992056 GGGTGGGGCTGGTGTGAATAGGG + Intergenic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130312969 15:82771037-82771059 GGGTGAGAGTGGTCAGAATAAGG - Intronic
1131078203 15:89512371-89512393 GAGTGGAATTGCTGGGAATTAGG - Intergenic
1131364488 15:91826999-91827021 GAGTGGAAGTGGTGGGTAGGGGG - Intergenic
1131971458 15:97897537-97897559 GTGTGTGAGTGTTGGGAAAAAGG - Intergenic
1132182342 15:99767091-99767113 GACTGAGAGTGGAGAGAATATGG + Intergenic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132301405 15:100778442-100778464 GAGTGGGATTGCTGGGCACATGG + Intergenic
1133368322 16:5228610-5228632 GAGGGGGAGGGGAGGGAAAAAGG + Intergenic
1133744375 16:8675495-8675517 GATTGGGAGCGGTGGGAGGATGG - Intronic
1134064809 16:11221256-11221278 GACTGGGATTGCTGGGTATAGGG - Intergenic
1134297952 16:12963232-12963254 GAGTGGGAATGGTGAGGACATGG + Intronic
1134532522 16:14995180-14995202 GAATAGGAGTGGTGAGAAGAGGG + Intronic
1134821654 16:17251915-17251937 GAGTGGGAGTTGTGGGGACAGGG + Intronic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1136736652 16:32473458-32473480 GAGGGTGGCTGGTGGGAATAGGG - Intergenic
1137018458 16:35398572-35398594 GAGTTGGGGTGGTGGGGATATGG + Intergenic
1137250716 16:46738507-46738529 GAGTGCAAGTGGCGTGAATATGG - Intronic
1138187171 16:54985604-54985626 GAGTGGGAGTGGGGTGAGTGAGG - Intergenic
1138240517 16:55423885-55423907 GGGAGGGAGTGGTGGCAATCAGG - Intronic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138334523 16:56242172-56242194 CAGTGGTAGTGGTAGTAATAAGG + Intronic
1138489346 16:57367052-57367074 GGGTGGGGGTGGTGAGAATGGGG - Intergenic
1139078009 16:63478349-63478371 GTGTGGCAGTGGTGGGGATGGGG + Intergenic
1139094190 16:63684770-63684792 GATTGGGAGGGCTGGCAATAGGG - Intergenic
1139391038 16:66606194-66606216 GGGTGGGAGTGAGGGGACTAGGG - Intronic
1140122660 16:72096904-72096926 GAGCGGGAGCGGCGGGAACATGG + Exonic
1140472304 16:75222743-75222765 GGGGGGGAGTGGGGTGAATAAGG - Intronic
1140891549 16:79289374-79289396 GAGTGGCAGTGGGGAGAAGATGG + Intergenic
1141028293 16:80568310-80568332 GGGTGGGAGAGGTGGGGATGTGG - Intergenic
1141028303 16:80568344-80568366 GAGTGGGAGACGTGGGGATGTGG - Intergenic
1141028323 16:80568412-80568434 GGGTGGGAGAGGTGGGGATGTGG - Intergenic
1141028345 16:80568480-80568502 GGGTGGGAGAGGTGGGAGTGTGG - Intergenic
1141028392 16:80568616-80568638 GGGTGGGAGTGGTGGGGATGTGG - Intergenic
1141028750 16:80570593-80570615 GGGTGGGAGTGGTGGGAGTGGGG - Intergenic
1141028839 16:80570827-80570849 GGGTGGGAGTGGTGGGGGTGGGG - Intergenic
1141028861 16:80570895-80570917 GAGTGGGAGTGGTGAGGGTGGGG - Intergenic
1141345012 16:83236805-83236827 GAGTGGCAGGGGTGGGAAGGAGG + Intronic
1141732700 16:85833596-85833618 GAGTGGGAGTGAGGGGAAAGCGG - Intergenic
1141882182 16:86867413-86867435 GAGTGGGAGCAGTGGAAATGAGG - Intergenic
1141999479 16:87655972-87655994 GAGTGGGACTGCTGGGAGTGGGG + Intronic
1142270747 16:89088211-89088233 GAGTGGTGGTGGTGGGAGGAAGG - Intergenic
1203016416 16_KI270728v1_random:356119-356141 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1203034751 16_KI270728v1_random:629277-629299 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1142669106 17:1479355-1479377 GAAGGGGAGTGATGGGAGTAGGG + Intronic
1143260167 17:5592830-5592852 GAGTGGCAGTGGTGTGATAACGG + Intronic
1143583034 17:7837247-7837269 AAGTGGGAGTGGTTGAAAGACGG + Intergenic
1143921554 17:10334217-10334239 GGGTGGGAGTGGTGGGGCCAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144128941 17:12227249-12227271 GAGTGGGAGAAGTGGGGAGATGG - Intergenic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1145115918 17:20210828-20210850 TGGAGGGAGGGGTGGGAATATGG - Intronic
1146409576 17:32571013-32571035 GAGGGGGAGTGCTGGGCAAAAGG + Intronic
1146414990 17:32623427-32623449 GTGTGGTAGTGGTGGGGATGGGG + Intronic
1146788249 17:35736198-35736220 GAGAGGGAGTGGAGAGAAAAAGG + Intronic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1147612361 17:41809557-41809579 GTCTAGGGGTGGTGGGAATATGG - Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1148032374 17:44630150-44630172 GTGGGGTAGTGGTGGGGATATGG - Intergenic
1148086528 17:44996926-44996948 GAGAGGGGATGGTGGGAACACGG + Intergenic
1148230116 17:45927527-45927549 CAGTGGGAGAGGTGGAGATATGG - Intronic
1148442548 17:47719175-47719197 GAGAGAGAGAGGAGGGAATAAGG + Intergenic
1148715160 17:49710798-49710820 GAGAGGGAGGCATGGGAATAGGG + Exonic
1148984991 17:51613396-51613418 GAGAGGGAGAGGTGGGGAGAGGG - Intergenic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1150461985 17:65361145-65361167 GGCTGGGAGGGGTGGGAATTTGG - Intergenic
1150899785 17:69259547-69259569 GACTGGGAGCTATGGGAATAGGG + Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151185741 17:72362724-72362746 GAGTAGGGGGGGTGGGAATGGGG + Intergenic
1151223145 17:72628377-72628399 CAGTGGGGGTGGTGGGAGCAGGG + Intergenic
1152436792 17:80281256-80281278 GAGTGTGAGTGGTGTGAGTGGGG - Intronic
1152436825 17:80281419-80281441 GTGTGTGAGTGGTGTGAATGGGG - Intronic
1152992756 18:377872-377894 GAGTGGGGCTGGGGGAAATAGGG + Intronic
1153434576 18:5055761-5055783 GAGTGGGATTGGTGGAAGTCTGG - Intergenic
1153522010 18:5962441-5962463 GACAGGGAGTGGCGGGAAGAGGG + Intronic
1153594684 18:6713037-6713059 TGGTGGCAGTGGTGGTAATATGG + Intergenic
1153999828 18:10473700-10473722 GAGTGGGTGTCTTGGGAAAATGG + Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155041613 18:22069792-22069814 GAATGGAAGTGGGGGGGATACGG - Intergenic
1155158078 18:23174437-23174459 GAGTGGGATTGTTGGTCATATGG + Intronic
1155339390 18:24798832-24798854 GAGGGAGAGGGGTGGGAATGAGG - Intergenic
1155523527 18:26693165-26693187 AAGTGGGATTGGTGGGTTTATGG + Intergenic
1156149507 18:34224931-34224953 GAGTGGGAGGGGTGGGGGTGAGG - Intronic
1156339196 18:36196078-36196100 GAGTGGGAGAGGTCTGAATGGGG + Intronic
1156575688 18:38312512-38312534 GGGTCAGAGTGGTGGTAATAGGG - Intergenic
1156810100 18:41238514-41238536 AAGTGGGAGTGATGATAATATGG + Intergenic
1157325086 18:46663206-46663228 GAGTGGGGTTGGTGGAAATGGGG - Intergenic
1157516688 18:48316336-48316358 GAGGAGGAGTGGTGGGGAGATGG - Intronic
1158162355 18:54499540-54499562 GAGTAGGGATGGGGGGAATAGGG + Intergenic
1162490439 19:10988022-10988044 AAGTGGCAGTGGTGGGCACAGGG - Intronic
1162575836 19:11498239-11498261 AGTTGGGAGCGGTGGGAATATGG - Intronic
1162661837 19:12175559-12175581 GAGTGGGAATAGGGGGCATAAGG - Intronic
1162699600 19:12504075-12504097 GAGTAAGAGTGGTAGGAATAGGG - Intronic
1163442228 19:17328061-17328083 GGGTGGGAGTGGTGATAACAGGG - Intronic
1164147351 19:22520084-22520106 GAGTGTGAGAGGTGGGAAAGAGG - Intronic
1164159247 19:22616026-22616048 GAGTGTGAGAGGTGGGAAAGAGG + Intergenic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1165706521 19:37980094-37980116 AAGTGGGAGTGATGGGGAGAGGG - Intronic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166034009 19:40154194-40154216 GGGTGGGTGAGGTGGGAATGGGG + Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1166656033 19:44612705-44612727 AAGTCGGAGAGGTGGGACTAAGG + Intergenic
1166809461 19:45506972-45506994 GAGTGGAAGTCGGGGGAGTAGGG - Intronic
1167348686 19:48962282-48962304 GAATGGGAGTGGGGGGAGGAGGG + Intergenic
1167390284 19:49190333-49190355 GGGTGAGAGTGGTGGGGATGGGG + Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1168144113 19:54409914-54409936 GAGTGGATGTGGTGGGGATGAGG - Intergenic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
1202713288 1_KI270714v1_random:28766-28788 GGGTGGGGGTGGTGGGGGTATGG + Intergenic
925535872 2:4915923-4915945 GGGTGGGAGTGGTTGCAGTATGG + Intergenic
925858632 2:8153915-8153937 GAATGGAAGTGGTGGTATTAGGG - Intergenic
926657997 2:15430735-15430757 GAGGGGGAATGGTGGAAAAATGG - Intronic
926705429 2:15834259-15834281 AGGTGGGAGGGGTGGGAATGAGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927868579 2:26608865-26608887 GAGAGGGAGAGGTGAGAAGAGGG - Intronic
929434119 2:41914252-41914274 GAGTGAGAGCGGTGGAAAGAGGG - Intergenic
929597251 2:43184115-43184137 GAGTGGGAGTGGTGGGGTGGGGG - Intergenic
929750320 2:44705265-44705287 GAGAGGGAGAGGTGGGAAGAGGG - Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
930711302 2:54553307-54553329 GAGTGGGAGAGGTGGGCAAGAGG + Intronic
930717739 2:54608577-54608599 GAGGGGGAGTGATGGGAAATAGG + Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931189652 2:59987923-59987945 GAGGTGGAGGGGTGGGTATAAGG + Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931226692 2:60337965-60337987 AAGGGGGAGTGCTGGGCATAGGG - Intergenic
931311460 2:61085001-61085023 GATTGGGAGAGGAAGGAATAGGG + Intronic
932083883 2:68740208-68740230 GAATGGCAGTGATGGGAACAGGG - Intronic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932418352 2:71586944-71586966 GGGTGGGAGCAGTGGGAGTAGGG - Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933532228 2:83525217-83525239 AAGTGGGGAGGGTGGGAATAGGG + Intergenic
934308810 2:91845373-91845395 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
935586176 2:104802004-104802026 GAGTGGCAGGGGTTGGAATTGGG - Intergenic
935728040 2:106040802-106040824 GAGTGTGAGTGGTGGGGCTGAGG - Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
937150661 2:119683506-119683528 GGGTGGGAGTGGTGAGAAAGTGG - Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937785959 2:125898458-125898480 GAGTAGGAGTGGTGGTAAGCAGG + Intergenic
938750024 2:134319558-134319580 CAGTGGGAGTGATGGGACAATGG + Intronic
940589118 2:155697842-155697864 GAGGGTGAATGGTGGGAAGAGGG - Intergenic
942305041 2:174599196-174599218 GAGTGGGAATGGTGGGGGCAGGG + Intronic
943624972 2:190188093-190188115 GAGAGGGAGTGGTGGGTGGAAGG + Intronic
943645172 2:190402132-190402154 GAGTTGGAGTGGTGTGTATAGGG + Intergenic
945218894 2:207464434-207464456 CAGGGGAAGAGGTGGGAATAGGG + Intergenic
945536865 2:211028031-211028053 GTGTTGGAGTAGTGGGTATATGG - Intergenic
946049283 2:216848500-216848522 GAGGGGTGGTGGTGGTAATATGG + Intergenic
946302628 2:218833188-218833210 GATTTGGAGGGCTGGGAATAAGG - Intergenic
946433391 2:219637212-219637234 GTGTGGGTGTGGTGTGAGTATGG + Intronic
946625149 2:221603706-221603728 AAGAGTGAGTGGTGGGAAAATGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947443540 2:230144230-230144252 GAGTGGGAGACCTGGGAAAATGG - Intergenic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947749846 2:232526337-232526359 GAGTGGGAGTGGAGTGAGTGAGG - Intronic
947859213 2:233347129-233347151 GAGTGGGAGGGTTGGGGAGAGGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948224221 2:236296368-236296390 GGGTGGGTGTGTTGAGAATAGGG - Intergenic
948609718 2:239159177-239159199 GGGTGGGAGTAGTGTGAATTGGG - Intronic
1168778057 20:464574-464596 GAGTTGTGGTGGTGGGAATGGGG - Intergenic
1169644053 20:7789568-7789590 GTGTGGGAGTAGGGGGTATATGG + Intergenic
1170190117 20:13637360-13637382 AAGTGGAATTGGTGGGCATATGG - Intronic
1170950365 20:20930878-20930900 GAGAGGGCATGGTGGGGATAGGG - Intergenic
1170955545 20:20976119-20976141 GAGTGGGATTGCTGGTCATATGG + Intergenic
1171866114 20:30488477-30488499 GAGTGGGCGTGGTGGGCACCCGG - Intergenic
1171958730 20:31478180-31478202 GGGTGGGAGGGGTGGGAAGAGGG - Intronic
1172636038 20:36410633-36410655 GAGAGGGAGTGTGGGGGATAGGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173699685 20:45057562-45057584 GACTGGGAGAGGGGAGAATAGGG - Intronic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173766139 20:45611278-45611300 GAGTGGGGGTGGTGGGAGGCGGG + Intronic
1174829569 20:53800270-53800292 TAGTGGCAGTGGTGTGATTATGG + Intergenic
1175443115 20:59004465-59004487 GAGTGGCAGAGGTGGGACTGAGG + Intronic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1176095888 20:63344442-63344464 AATTTGGCGTGGTGGGAATATGG + Exonic
1177167894 21:17623690-17623712 TAGTGGGAGTTGTGGGACAAGGG - Intergenic
1178504731 21:33153287-33153309 GTCTGTGAGTGCTGGGAATATGG + Intergenic
1178903333 21:36615335-36615357 TAGTGGGAGTCGTGAGAATGGGG - Intergenic
1179133251 21:38657919-38657941 TAGTGGCAGTGGTGTGAGTAGGG - Intronic
1179585469 21:42371392-42371414 GAGTGTGAGTGGTGGTCAGAGGG - Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180742674 22:18064676-18064698 GGGTGGCAGAGGTGGGAATAAGG + Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181148958 22:20869283-20869305 GAGGGGTAGTGGTTGGAAGAAGG + Intronic
1182067710 22:27442366-27442388 AAGTGGGTGTGCTGGGAATGGGG - Intergenic
1182373005 22:29825352-29825374 GGGTCGGAGTGTTTGGAATAGGG - Intronic
1182869024 22:33629619-33629641 GAGTGGGAATGGGGAGAGTAGGG + Intronic
1183348248 22:37319659-37319681 AAGTGGGAGAGGTGGGAGTGGGG - Intergenic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1185119345 22:48956643-48956665 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
1185119353 22:48956743-48956765 GTGTGGGTGTGGTGTGAATGTGG - Intergenic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950378871 3:12594253-12594275 GAGTGGAAGTGCTGGGAAAATGG + Intronic
951008404 3:17646887-17646909 AAGTGGGAGGGGTTGGAACAGGG - Intronic
951232378 3:20194172-20194194 GATAGGGAGTGGTAGGAAGAAGG + Intergenic
951383194 3:22010903-22010925 GAGGGTGAGTGGTGGGAGGATGG - Intronic
951920529 3:27849578-27849600 GAGTGGCAGTGGTAGGATTGAGG - Intergenic
953390326 3:42530143-42530165 GAGTGGGTGGGGTGGGAGTGTGG + Intronic
953639008 3:44688228-44688250 GGGTGGTAATGGGGGGAATAGGG - Intergenic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
954146909 3:48639013-48639035 GAGAGGGACTGGTGGGAGTGGGG - Intronic
954366853 3:50151031-50151053 GAGGGGGAGTGTTGGGAAGGGGG - Intergenic
954593732 3:51806216-51806238 GAGTGGGAGAGGTGGTGAGAAGG + Intergenic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955557286 3:60151605-60151627 GAGGGAGAGTGGTAGGAATTGGG - Intronic
956606576 3:71078990-71079012 GAGTGGGCGTGGTAGGAAGTGGG - Intronic
956872369 3:73430673-73430695 GAGTGGGAGTTGGGGGTGTAAGG - Intronic
957078769 3:75620290-75620312 GAGGGGGAGCGGTGGGGAAACGG - Intergenic
957555546 3:81761346-81761368 AAGTGGGGGTGGTGGGATTCCGG + Intronic
957587020 3:82145965-82145987 GAGTGGGAGTGGTAGTGATGAGG + Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958505659 3:94973895-94973917 AAGTGGAAGTGGTGGGGAGAGGG - Intergenic
959795459 3:110422589-110422611 TAGTGAGAGTGGTGGTAATGCGG + Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
960488417 3:118280768-118280790 GGGTGGGAGTGGTGGTGATGAGG + Intergenic
960573721 3:119209299-119209321 GAGTGGAAGTGATGGGGGTAAGG + Intergenic
960913884 3:122678444-122678466 GAGGTGGAGTGGTGGGCATGAGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961651610 3:128419565-128419587 GAAGGGCAGTGGTGGGAAAAGGG + Intergenic
961678320 3:128582011-128582033 GAGGGGGAGGGGTGGGAGGAAGG - Intergenic
962191786 3:133318731-133318753 GAGGGGGAGTTCTGGGAAGATGG + Intronic
962883752 3:139603659-139603681 TAGTGGCAGCGGTGGTAATATGG - Intronic
962975586 3:140443081-140443103 GAGTGAGAGGGATGGGAATGGGG - Intronic
965386400 3:168051196-168051218 GAGAGGGAGTGTGGGGGATATGG + Intronic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
966193805 3:177294535-177294557 GAGTGGGAGTTGTGAGAGTCGGG + Intergenic
966971795 3:185051262-185051284 TAGTGTCATTGGTGGGAATAAGG + Intronic
967644225 3:191901680-191901702 GAGAGAGAGTAGTAGGAATAAGG - Intergenic
967774180 3:193369191-193369213 GAGTGGAAGTGGTGCAATTATGG - Intronic
969103022 4:4784304-4784326 GTGTGTGTGTGGTGGGGATAAGG - Intergenic
969515679 4:7646955-7646977 GAGGGGGTTTGGTGGGAACAGGG + Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
972953876 4:44365159-44365181 CAGGGAGAGTGGTGGGCATATGG + Intronic
973142058 4:46781680-46781702 GAGAGGGAATGGTGGGAACCTGG + Intronic
975553524 4:75637374-75637396 GAGTGCAAGTGGTGTGAACATGG + Intergenic
975941883 4:79657869-79657891 GAATAGGAGTGGTGGGAGTGGGG - Intergenic
976371593 4:84295043-84295065 GAGGGTGAGAGGTGGGGATAGGG - Intergenic
976486602 4:85612667-85612689 AAATGTGAGTGGTGGGTATATGG - Intronic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
979365642 4:119819572-119819594 GGCTGGGAGTGGGGGAAATAGGG - Intergenic
979979693 4:127239202-127239224 GAGTGAGAGGGCAGGGAATAAGG + Intergenic
981320505 4:143386436-143386458 GAGTGGCAGTGGTGTGATCATGG + Intronic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
983060875 4:163158868-163158890 GAGTGGAAGGGGAGGTAATAAGG - Intronic
983398586 4:167234369-167234391 GAGGAGGAGAGGTGGGTATAAGG + Intronic
983995170 4:174174191-174174213 GAGTGGAAGAGGAGAGAATATGG + Intergenic
984173773 4:176391157-176391179 GAGAGGGAGTGGCTGGAAAAGGG - Intergenic
984722936 4:182993087-182993109 AAATGGGAGTGGGGAGAATATGG + Intergenic
985137477 4:186801746-186801768 GAGTGGGGGTGGTGGGAGAGAGG + Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
987137149 5:14910957-14910979 GAGTGGGGGTTATGGGAATTTGG + Intergenic
987271132 5:16310448-16310470 GAGTGTGAGTGGTGTGAGTGTGG - Intergenic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
988797674 5:34666965-34666987 GACTGTTAGTGGTGGGAATGGGG + Intronic
988854927 5:35219126-35219148 GAGTTGGACTGGTGGGGAGATGG - Intronic
989651338 5:43694318-43694340 GACTAGGAGTGGTGAGAAGAGGG + Intronic
989993134 5:50792779-50792801 CAGTGGAAGTGGTGAGAAAAGGG - Intronic
990768078 5:59209988-59210010 GTGTAGGAGTGATGGGACTAGGG - Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992467707 5:77023560-77023582 GAATGGGAGAGGAGAGAATAAGG - Intergenic
992550775 5:77857602-77857624 GAGTGGTAGTGGAGGTATTAGGG - Intronic
993492553 5:88569779-88569801 GTGTGGGAGTGGCAGGAATGTGG - Intergenic
993525164 5:88956368-88956390 GAGAGGAAGTGTTGGGAAGAGGG + Intergenic
994735615 5:103551169-103551191 GAGTTGCAGTGGTGGGATCATGG + Intronic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995393994 5:111667828-111667850 GAGTGGCAGTGGTGCGATCATGG - Intronic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
997905200 5:137809361-137809383 GACAGGTAATGGTGGGAATAGGG + Intergenic
998025629 5:138813526-138813548 GGTTGGGAGTAGTGGGAGTAGGG + Intronic
998600711 5:143582000-143582022 GAGGGGGAGTGGGGGAAATCTGG + Intergenic
1000332864 5:160219627-160219649 GGATGGGAGTGGTGGGGCTATGG - Intronic
1000957470 5:167559980-167560002 GAGTGGGAGGGGTGAGAGGAGGG - Intronic
1001960158 5:175875194-175875216 AAGTGAGAGGGGTGGGATTAAGG + Intronic
1002602114 5:180359916-180359938 GAGTGGGAGGGGAGGCAGTAGGG + Intergenic
1003312575 6:4982559-4982581 GATTGGGAGGCGTGAGAATAGGG - Intergenic
1003375324 6:5571809-5571831 GAGAGGGATTGGTGGAAATGGGG - Intronic
1003469733 6:6418051-6418073 TAGTGGGAGTGGTGGGTGGAGGG - Intergenic
1003477614 6:6498549-6498571 GAGTGGGAGTGGAGGATAAAGGG - Intergenic
1003663810 6:8089779-8089801 GAGGTGGAATGGTAGGAATATGG + Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004664607 6:17738335-17738357 AAGTGGGAGTGGTGCAAATGTGG + Intergenic
1004899381 6:20180359-20180381 GAGTGGAAGTGGTTGGGAAAAGG - Intronic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1006026642 6:31151175-31151197 AAGTGGGAGTGAAGGGAACAAGG - Intronic
1006441203 6:34054725-34054747 GACTGGAAGTGGTGGCAAGATGG - Intronic
1007109425 6:39304427-39304449 GAGGGGCTGTGGTGGGAATTGGG - Intronic
1007991022 6:46256059-46256081 AAGTGGGAGAGGTTAGAATAGGG + Intronic
1008641488 6:53467181-53467203 GAGGGGCAGTGGTGGAAATAGGG - Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009900512 6:69803145-69803167 GCGTGCGTGTGGTGAGAATATGG - Intergenic
1010141819 6:72621875-72621897 GAGTGGTAGTCGCGGGAATGAGG + Exonic
1010995055 6:82523468-82523490 AGGTGGTAGTAGTGGGAATAGGG + Intergenic
1012575288 6:100788848-100788870 AACTGGGAGTGGTGGGAAAGAGG + Intronic
1012604066 6:101134867-101134889 TAGTAGGAATGGTAGGAATAAGG - Intergenic
1013118397 6:107120467-107120489 GAGAGGGTGAGGTGGGAAGATGG - Intergenic
1013373915 6:109495848-109495870 GAGAGGGAGCGGTGGGACCAAGG - Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015445845 6:133303928-133303950 GAGGTGGAGTGGTGGGTACAGGG + Intronic
1016120894 6:140340066-140340088 AAGTGGGAGTCCTGGGAATTGGG + Intergenic
1016375966 6:143421033-143421055 GTGTGGGAGTGGTGGGTCTCAGG - Intergenic
1016454364 6:144215737-144215759 GAGTGGAAGTCCTGGGAAAAGGG + Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017634041 6:156426122-156426144 GAGTGGGAGTTCTGGGCTTAGGG + Intergenic
1018207083 6:161445914-161445936 GAGATGGAGTGGCGGGGATAGGG + Intronic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059205 6:169243158-169243180 AGGTGGGAGAGGTGGGAATGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019125963 6:169840240-169840262 GAGTGGGAGTGGTGTGGAGTGGG - Intergenic
1019443372 7:1058652-1058674 GAGTGGCATTTGTGGGAAAAAGG - Exonic
1019690081 7:2405553-2405575 AAGTGGTCGTGGTGAGAATATGG + Intronic
1020434966 7:8152497-8152519 GAGTGGTAGTGGTGGTGGTAAGG - Intronic
1020705980 7:11544810-11544832 GTGTGGGAGTGGTGGGGGTGGGG - Intronic
1020839831 7:13202229-13202251 AAATTGGAGTGGTGTGAATAAGG - Intergenic
1020854891 7:13407096-13407118 GAGGGAGAGTGATGGGAAGATGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023347200 7:39283422-39283444 GCTTGGGAGTGGAGGGAATGGGG - Intronic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023775282 7:43599848-43599870 GAGTGGGAGTGTAGGGAGCAGGG + Intronic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024829638 7:53435103-53435125 GTCTGGGAGAGATGGGAATATGG - Intergenic
1024977739 7:55129566-55129588 GGGTGGGAGTGGTGAGGGTAGGG + Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026255142 7:68704720-68704742 GAAGGCGAGTGGTGGAAATAAGG - Intergenic
1026546158 7:71324317-71324339 GAGATGGAGAGGTGAGAATAGGG + Intronic
1027131431 7:75593934-75593956 GAGTGGGTGTGTTTGGAATTAGG - Intronic
1027135845 7:75623428-75623450 GAGTGGCAGGGATGGGAATGGGG + Intronic
1028198335 7:87933220-87933242 GAGTGCAAGTGGTGAGAACACGG - Intergenic
1028609794 7:92697970-92697992 GACTGGGAATGATGAGAATATGG - Intronic
1028644969 7:93085853-93085875 GAGAGGGTATGATGGGAATAAGG + Intergenic
1029049338 7:97668265-97668287 GAAAAGGAGAGGTGGGAATAGGG - Intergenic
1029131694 7:98336148-98336170 GGGTGGGAGAGAGGGGAATAAGG + Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030083475 7:105797706-105797728 GAGTGGGAGAGATGAGAAGAAGG - Intronic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032928507 7:136637900-136637922 GAATGTGGGTGGTGGGAAGAGGG - Intergenic
1033060008 7:138097106-138097128 GAGGTGGGGTGGTGGGAATGAGG - Intronic
1034575070 7:151989605-151989627 AAGTGGAATTGCTGGGAATAAGG + Intronic
1036286310 8:7446844-7446866 GACGGGGAGTGGTTGGAATGAGG + Intronic
1036335166 8:7864684-7864706 GACGGGGAGTGGTTGGAATGAGG - Intronic
1038394143 8:27234414-27234436 GAGAGAGAGTGCTGGGAACAAGG + Intergenic
1038493122 8:27983923-27983945 GAGGGCGAGAGGTGGGAAGAGGG - Intronic
1039455516 8:37703374-37703396 GGGAGGGAGTGCTGGGATTAGGG - Intergenic
1039870819 8:41543754-41543776 GAGTGGCAGTGGTGTGAACACGG + Exonic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042271019 8:66955981-66956003 GAGTGGTAGTGGTGTGATCATGG + Intronic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1045628466 8:104085935-104085957 GCTTGGGAGAGGTGAGAATAAGG + Intronic
1046932320 8:119854210-119854232 GGGAGAGAGTGGTGGGAACAGGG - Intronic
1046949540 8:120006552-120006574 GAGTGCCAGGGGTGGGGATAAGG - Intronic
1047004050 8:120601231-120601253 GAGGGGGAGTGGTCAGCATAGGG + Intronic
1047493058 8:125390095-125390117 GAGTGGGAGAAGTTGCAATAGGG + Intergenic
1047549347 8:125852848-125852870 AGGTGGCAGTGGTGGGAATCCGG - Intergenic
1048609191 8:136003426-136003448 GGGTGGGAATGGTGTGAAAATGG + Intergenic
1049406800 8:142455231-142455253 GAGTGGGAGTGATGGGGGGAAGG - Intronic
1050177894 9:2887949-2887971 GAATAGGAGTGGTGAGAGTAGGG - Intergenic
1050634696 9:7599054-7599076 GAGTAGAAGTGGTGAGAACAGGG - Intergenic
1051344636 9:16140980-16141002 GAGTGGCAGTGCTGTGAAGAAGG + Intergenic
1052383799 9:27801599-27801621 GGCTGGGACTGGAGGGAATAAGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1054739594 9:68791357-68791379 GAGTGGGAGTGAGGGGATGATGG + Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056534659 9:87517043-87517065 GAGAGGCACTGGTGGGACTATGG - Intronic
1057934468 9:99225303-99225325 GATAGAGAGTGGTGGGGATAGGG + Intronic
1059406272 9:114099694-114099716 GGGTGGGAGTGGGGGGTATGTGG - Intergenic
1060101841 9:120847376-120847398 GAGGGGGAGTGGGGGGAGTGTGG + Intergenic
1060558910 9:124526754-124526776 GAGTGGCTGGGGTGGGAAAAGGG - Intronic
1060745463 9:126127998-126128020 AAGAGGGAGTGGTGGGGAAAGGG + Intergenic
1061081486 9:128373431-128373453 GAGTGGGAGTGGGGCCACTAAGG - Intronic
1061180478 9:129022475-129022497 GTGGGGGAGTGGTGGGGAAAGGG + Intronic
1061644266 9:131987426-131987448 GAGGGGGAGCGGTGGGAATGTGG + Intronic
1062542692 9:137048582-137048604 TTGTGGGAGGGGTGGGAGTACGG + Exonic
1062686226 9:137814848-137814870 GAGTGTGAGGGGTGTGAAGAGGG + Intronic
1185963773 X:4576820-4576842 GAGTGGGAGTAGTGGCTTTATGG + Intergenic
1186463864 X:9769317-9769339 AAGTGGGAATGGTGGGTAAATGG - Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186995309 X:15115079-15115101 GACTTGGAGAGCTGGGAATAAGG - Intergenic
1187411623 X:19055701-19055723 GAGAGAGAGTGATGGGAATCAGG + Intronic
1189097393 X:38154988-38155010 GATTGGGTGTGGAGGGCATAGGG - Intronic
1189410350 X:40765023-40765045 GAGTGGCAGTGGTGGTGGTACGG + Intergenic
1189865588 X:45323803-45323825 GAGTGGGAAGGGTGGGGATGGGG - Intergenic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1194020341 X:88682576-88682598 GTGTGGGAGTAGTGGGTATATGG - Intergenic
1194791472 X:98156270-98156292 GAATAGGAGTGGTGAGAATGGGG - Intergenic
1195212149 X:102660415-102660437 GGGTGGGAGAGGTGGGCATATGG + Intergenic
1195218191 X:102721188-102721210 GGGTGGGGGAGGTGGGCATATGG + Intronic
1196604985 X:117646735-117646757 GGGTGGGGGTGGGGGGAGTATGG - Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1197648638 X:129042238-129042260 CAGTGGGAGTGGTGGAGATGGGG + Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1199644226 X:149890142-149890164 GAGTAGCAGTGGTGGGAGTGTGG - Intergenic
1200112058 X:153745337-153745359 GAGGGTGGCTGGTGGGAATAGGG + Intergenic
1200342456 X:155411792-155411814 TGGTGGGTGTGGTGGAAATAGGG + Intergenic