ID: 1198936423

View in Genome Browser
Species Human (GRCh38)
Location X:141905411-141905433
Sequence GACAAGGATATGCCTACTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198936416_1198936423 6 Left 1198936416 X:141905382-141905404 CCTCCTCTCTGCTTCTGCGTTCT 0: 1
1: 0
2: 4
3: 53
4: 536
Right 1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 68
1198936414_1198936423 30 Left 1198936414 X:141905358-141905380 CCTGTTTTTCTTTCTCATCCTCA 0: 1
1: 0
2: 5
3: 98
4: 1017
Right 1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 68
1198936417_1198936423 3 Left 1198936417 X:141905385-141905407 CCTCTCTGCTTCTGCGTTCTCCA 0: 1
1: 1
2: 1
3: 87
4: 679
Right 1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 68
1198936415_1198936423 12 Left 1198936415 X:141905376-141905398 CCTCATCCTCCTCTCTGCTTCTG 0: 1
1: 1
2: 58
3: 841
4: 3257
Right 1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198936423 Original CRISPR GACAAGGATATGCCTACTGC TGG Exonic
903488533 1:23709680-23709702 CTCAAGGATATTGCTACTGCAGG - Intergenic
921253228 1:213316868-213316890 ACCAAGCACATGCCTACTGCAGG - Intergenic
1068397133 10:56477493-56477515 GACAAGGAAATACCTAGTGGAGG + Intergenic
1072716544 10:97756236-97756258 GAGAAGAACAAGCCTACTGCTGG - Intronic
1073583652 10:104688869-104688891 GACAAGGAGATGCCCAGGGCAGG + Intronic
1078772941 11:14367625-14367647 GTCAAGGATATGCCTAATCATGG + Intergenic
1083178032 11:60965064-60965086 GACAAGCATTTCTCTACTGCAGG - Intergenic
1083626709 11:64075570-64075592 GACAAGGATCTGGCTGCTGAGGG - Intronic
1085958545 11:81431655-81431677 GACAAGATTCTGCCAACTGCAGG - Intergenic
1087190287 11:95247223-95247245 GACAAAATTATGCTTACTGCAGG - Intergenic
1089838020 11:121388828-121388850 TACAAGCATATACCTTCTGCAGG - Intergenic
1091884101 12:4003414-4003436 GGCTAGGATATGCCAGCTGCAGG + Intergenic
1091928010 12:4371053-4371075 GACAAGGTGGTGCCTACTCCAGG - Intronic
1094630332 12:32167770-32167792 GACAGGGATTTCCCTATTGCTGG + Intronic
1107255235 13:38418018-38418040 GAGGAGGATATGCATACGGCAGG + Intergenic
1110725707 13:78820702-78820724 GACAAAGATAAGCAAACTGCAGG - Intergenic
1113533830 13:111048779-111048801 GACAAGGATGTGCTCACTGATGG - Intergenic
1115513914 14:34166343-34166365 GACAAGTATTTGCCTTGTGCTGG - Intronic
1116395212 14:44439947-44439969 GACAAGGAAATGCCAACTCTAGG + Intergenic
1120284335 14:82478841-82478863 GGCAAGGTTCTGCCTACTTCTGG - Intergenic
1122751508 14:103937231-103937253 GACAAGGAGATGCCCAATGGAGG - Intronic
1202862901 14_GL000225v1_random:94757-94779 GTCTAGGATATGCCTACAGGGGG + Intergenic
1128354902 15:66919254-66919276 GACCAGGAGAGGCCTACTGGAGG + Intergenic
1139289051 16:65840725-65840747 GCCAAGGAAATCCCTACAGCAGG + Intergenic
1146199812 17:30847216-30847238 GACAAAAGTATACCTACTGCAGG - Intronic
1146535884 17:33651746-33651768 GACAGGGACATGGCTACAGCTGG - Intronic
1147801248 17:43090244-43090266 TTTAAGAATATGCCTACTGCAGG - Intronic
1152965323 18:109193-109215 GACTAGGATCTGCCTACAGGAGG + Intergenic
1158411077 18:57206515-57206537 GACAGGGATAAGACTACTGTGGG - Intergenic
1161086539 19:2338135-2338157 CACAGGGACATGCCGACTGCTGG + Intronic
1164314932 19:24079153-24079175 AACATGGACATGCCTGCTGCAGG - Intronic
925786121 2:7432392-7432414 GACAGGGATGATCCTACTGCAGG - Intergenic
937821040 2:126311427-126311449 GACCAGGAAATTCCTACTGTTGG - Intergenic
946669749 2:222090040-222090062 AACAAGATTCTGCCTACTGCTGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1180975039 22:19843597-19843619 GAGACGGATATGCCTGATGCAGG - Intronic
1181865714 22:25853374-25853396 GACAAGGCAATGCCTTCTGCAGG + Intronic
956189195 3:66592516-66592538 AACAAGGATATGGCTACTAGCGG + Intergenic
959395038 3:105826658-105826680 TACAAGGATGTACCTGCTGCTGG + Intronic
961813051 3:129532764-129532786 AACAAGCAGGTGCCTACTGCGGG + Exonic
964955450 3:162350208-162350230 GACAGGGTTATGCCTACTTAAGG - Intergenic
972319995 4:37964641-37964663 GACAAGGGGCAGCCTACTGCGGG + Intronic
973858318 4:55035478-55035500 GACAAGCAGATGCCTACATCAGG - Intergenic
976555108 4:86441771-86441793 GACAAGCATCTGTCTACTCCAGG + Intronic
980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG + Intergenic
981048191 4:140285229-140285251 TACAAGGATATGTCGATTGCAGG - Intronic
986312685 5:6565667-6565689 AACAAGCATTTGCCAACTGCTGG + Intergenic
987271791 5:16317045-16317067 GTCAAGGATTTGACTACTTCTGG + Intergenic
988347573 5:30058008-30058030 CAAAAGGATATGCATACTTCAGG + Intergenic
988389751 5:30612398-30612420 GGCAAGGGTATGCCTCCTACAGG + Intergenic
990299096 5:54432796-54432818 GACATGGAGATGTCCACTGCAGG + Intergenic
993728210 5:91392437-91392459 GACAACGATATGTCTCCTGGTGG + Intergenic
994698671 5:103104834-103104856 GACAAGCATATACCTACAACAGG + Exonic
996353044 5:122566728-122566750 GGCAGGGATATGCCTTCTGAGGG - Intergenic
1006824904 6:36927814-36927836 GACAGGGAAATGCCTGCTGCTGG - Intronic
1007623046 6:43226415-43226437 GTCAAGGACATGCCTCATGCTGG + Intronic
1015808881 6:137141611-137141633 GACAGGGCTGTGGCTACTGCCGG - Intergenic
1020350025 7:7209599-7209621 GATAAGGATCAGCCTACTCCTGG + Intronic
1020435816 7:8161344-8161366 GACAAGGAAATGATTAATGCTGG + Intronic
1023673896 7:42609854-42609876 GACAAGGATATGTTTGCTGAGGG + Intergenic
1026898788 7:74026016-74026038 GCCCAGGATGTGCCTGCTGCAGG - Intergenic
1038235513 8:25749629-25749651 GACCACGATGTGCCTACTGGTGG - Intergenic
1041973752 8:63773569-63773591 GACACTAAGATGCCTACTGCAGG - Intergenic
1042967408 8:74369750-74369772 GACAATGATATGCCTACGTGAGG - Intronic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1061587329 9:131577437-131577459 GACACGGTTCTGCCTGCTGCTGG + Exonic
1187675067 X:21708193-21708215 CACAAGGATATTCCCCCTGCTGG + Intronic
1190385235 X:49878435-49878457 GACAAGGCCATCCCTACAGCTGG - Intergenic
1194727863 X:97419219-97419241 GACAAGCATATGCTAATTGCTGG - Intronic
1198332267 X:135632861-135632883 GACAGGCATATGTCTACTGCTGG - Intergenic
1198935208 X:141896884-141896906 GATGAGGATATGCCTGCTGCTGG + Exonic
1198936423 X:141905411-141905433 GACAAGGATATGCCTACTGCTGG + Exonic
1198962256 X:142195252-142195274 GACAAGGACATGCCTGCTGCTGG - Intergenic
1200923628 Y:8635015-8635037 GAGAAGGATCTGCCTTGTGCTGG - Intergenic