ID: 1198937749

View in Genome Browser
Species Human (GRCh38)
Location X:141916647-141916669
Sequence GTCTCCTGTCCAGAATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198937749_1198937750 -6 Left 1198937749 X:141916647-141916669 CCTCTCTATTCTGGACAGGAGAC No data
Right 1198937750 X:141916664-141916686 GGAGACTTATTTCCAATACCAGG 0: 2
1: 1
2: 5
3: 10
4: 102
1198937749_1198937753 9 Left 1198937749 X:141916647-141916669 CCTCTCTATTCTGGACAGGAGAC No data
Right 1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG No data
1198937749_1198937751 -3 Left 1198937749 X:141916647-141916669 CCTCTCTATTCTGGACAGGAGAC No data
Right 1198937751 X:141916667-141916689 GACTTATTTCCAATACCAGGAGG 0: 2
1: 1
2: 1
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198937749 Original CRISPR GTCTCCTGTCCAGAATAGAG AGG (reversed) Intergenic
No off target data available for this crispr