ID: 1198937753

View in Genome Browser
Species Human (GRCh38)
Location X:141916679-141916701
Sequence ATACCAGGAGGTAAAATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198937749_1198937753 9 Left 1198937749 X:141916647-141916669 CCTCTCTATTCTGGACAGGAGAC No data
Right 1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG No data
1198937745_1198937753 25 Left 1198937745 X:141916631-141916653 CCCAAGAACATTAGTACCTCTCT No data
Right 1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG No data
1198937746_1198937753 24 Left 1198937746 X:141916632-141916654 CCAAGAACATTAGTACCTCTCTA No data
Right 1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198937753 Original CRISPR ATACCAGGAGGTAAAATGAT AGG Intergenic
No off target data available for this crispr