ID: 1198939790

View in Genome Browser
Species Human (GRCh38)
Location X:141941020-141941042
Sequence TGGTAGCTCTTCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198939784_1198939790 0 Left 1198939784 X:141940997-141941019 CCAAAGTCTGTGATATGTATTCC No data
Right 1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG No data
1198939783_1198939790 3 Left 1198939783 X:141940994-141941016 CCTCCAAAGTCTGTGATATGTAT No data
Right 1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG No data
1198939782_1198939790 7 Left 1198939782 X:141940990-141941012 CCTACCTCCAAAGTCTGTGATAT No data
Right 1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198939790 Original CRISPR TGGTAGCTCTTCAGGGAAGA GGG Intergenic
No off target data available for this crispr