ID: 1198941870

View in Genome Browser
Species Human (GRCh38)
Location X:141965146-141965168
Sequence CATGGGAGGAACCCGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198941870_1198941883 24 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941870_1198941885 26 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941885 X:141965195-141965217 TTCAGGAGGAGATTTGGGTGGGG No data
1198941870_1198941878 -5 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941878 X:141965164-141965186 CCATGACATGTGGCAATTATTGG No data
1198941870_1198941881 20 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941881 X:141965189-141965211 CTGTAATTCAGGAGGAGATTTGG No data
1198941870_1198941880 12 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941880 X:141965181-141965203 TATTGGAGCTGTAATTCAGGAGG No data
1198941870_1198941882 21 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941882 X:141965190-141965212 TGTAATTCAGGAGGAGATTTGGG No data
1198941870_1198941884 25 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941884 X:141965194-141965216 ATTCAGGAGGAGATTTGGGTGGG No data
1198941870_1198941879 9 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198941870 Original CRISPR CATGGGAGGAACCCGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr