ID: 1198941873

View in Genome Browser
Species Human (GRCh38)
Location X:141965153-141965175
Sequence CACATGTCATGGGAGGAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8384
Summary {0: 50, 1: 370, 2: 1057, 3: 2632, 4: 4275}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198941873_1198941885 19 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941885 X:141965195-141965217 TTCAGGAGGAGATTTGGGTGGGG No data
1198941873_1198941880 5 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941880 X:141965181-141965203 TATTGGAGCTGTAATTCAGGAGG No data
1198941873_1198941883 17 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941873_1198941881 13 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941881 X:141965189-141965211 CTGTAATTCAGGAGGAGATTTGG No data
1198941873_1198941879 2 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941873_1198941882 14 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941882 X:141965190-141965212 TGTAATTCAGGAGGAGATTTGGG No data
1198941873_1198941884 18 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941884 X:141965194-141965216 ATTCAGGAGGAGATTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198941873 Original CRISPR CACATGTCATGGGAGGAACC CGG (reversed) Intergenic
Too many off-targets to display for this crispr