ID: 1198941875

View in Genome Browser
Species Human (GRCh38)
Location X:141965160-141965182
Sequence TAATTGCCACATGTCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10615
Summary {0: 3, 1: 165, 2: 1009, 3: 3216, 4: 6222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198941875_1198941884 11 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941884 X:141965194-141965216 ATTCAGGAGGAGATTTGGGTGGG No data
1198941875_1198941881 6 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941881 X:141965189-141965211 CTGTAATTCAGGAGGAGATTTGG No data
1198941875_1198941885 12 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941885 X:141965195-141965217 TTCAGGAGGAGATTTGGGTGGGG No data
1198941875_1198941880 -2 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941880 X:141965181-141965203 TATTGGAGCTGTAATTCAGGAGG No data
1198941875_1198941879 -5 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941875_1198941883 10 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941875_1198941882 7 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941882 X:141965190-141965212 TGTAATTCAGGAGGAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198941875 Original CRISPR TAATTGCCACATGTCATGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr