ID: 1198941879

View in Genome Browser
Species Human (GRCh38)
Location X:141965178-141965200
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198941872_1198941879 5 Left 1198941872 X:141965150-141965172 CCACCGGGTTCCTCCCATGACAT No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941875_1198941879 -5 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941870_1198941879 9 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941865_1198941879 29 Left 1198941865 X:141965126-141965148 CCACCTCCATAATTCAATTACCT No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941873_1198941879 2 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941864_1198941879 30 Left 1198941864 X:141965125-141965147 CCCACCTCCATAATTCAATTACC 0: 5
1: 113
2: 963
3: 3012
4: 3542
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941871_1198941879 6 Left 1198941871 X:141965149-141965171 CCCACCGGGTTCCTCCCATGACA No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941867_1198941879 23 Left 1198941867 X:141965132-141965154 CCATAATTCAATTACCTCCCACC 0: 86
1: 2138
2: 5719
3: 9648
4: 10816
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941876_1198941879 -8 Left 1198941876 X:141965163-141965185 CCCATGACATGTGGCAATTATTG No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941877_1198941879 -9 Left 1198941877 X:141965164-141965186 CCATGACATGTGGCAATTATTGG No data
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data
1198941866_1198941879 26 Left 1198941866 X:141965129-141965151 CCTCCATAATTCAATTACCTCCC 0: 142
1: 3520
2: 6706
3: 9469
4: 9786
Right 1198941879 X:141965178-141965200 AATTATTGGAGCTGTAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198941879 Original CRISPR AATTATTGGAGCTGTAATTC AGG Intergenic
No off target data available for this crispr