ID: 1198941883

View in Genome Browser
Species Human (GRCh38)
Location X:141965193-141965215
Sequence AATTCAGGAGGAGATTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198941870_1198941883 24 Left 1198941870 X:141965146-141965168 CCTCCCACCGGGTTCCTCCCATG No data
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941877_1198941883 6 Left 1198941877 X:141965164-141965186 CCATGACATGTGGCAATTATTGG No data
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941871_1198941883 21 Left 1198941871 X:141965149-141965171 CCCACCGGGTTCCTCCCATGACA No data
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941873_1198941883 17 Left 1198941873 X:141965153-141965175 CCGGGTTCCTCCCATGACATGTG 0: 50
1: 370
2: 1057
3: 2632
4: 4275
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941872_1198941883 20 Left 1198941872 X:141965150-141965172 CCACCGGGTTCCTCCCATGACAT No data
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941876_1198941883 7 Left 1198941876 X:141965163-141965185 CCCATGACATGTGGCAATTATTG No data
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data
1198941875_1198941883 10 Left 1198941875 X:141965160-141965182 CCTCCCATGACATGTGGCAATTA 0: 3
1: 165
2: 1009
3: 3216
4: 6222
Right 1198941883 X:141965193-141965215 AATTCAGGAGGAGATTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198941883 Original CRISPR AATTCAGGAGGAGATTTGGG TGG Intergenic
No off target data available for this crispr