ID: 1198942399

View in Genome Browser
Species Human (GRCh38)
Location X:141971002-141971024
Sequence CCTTCTAGGGATGGGATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198942399_1198942405 1 Left 1198942399 X:141971002-141971024 CCATCTATCCCATCCCTAGAAGG No data
Right 1198942405 X:141971026-141971048 TTTAAAAATATTTTTCATTATGG No data
1198942399_1198942407 13 Left 1198942399 X:141971002-141971024 CCATCTATCCCATCCCTAGAAGG No data
Right 1198942407 X:141971038-141971060 TTTCATTATGGCTGTATGGTAGG No data
1198942399_1198942406 9 Left 1198942399 X:141971002-141971024 CCATCTATCCCATCCCTAGAAGG No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198942399 Original CRISPR CCTTCTAGGGATGGGATAGA TGG (reversed) Intergenic
No off target data available for this crispr