ID: 1198942403

View in Genome Browser
Species Human (GRCh38)
Location X:141971015-141971037
Sequence AATATTTTTAAAGCCTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198942403_1198942406 -4 Left 1198942403 X:141971015-141971037 CCCTAGAAGGCTTTAAAAATATT No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data
1198942403_1198942407 0 Left 1198942403 X:141971015-141971037 CCCTAGAAGGCTTTAAAAATATT No data
Right 1198942407 X:141971038-141971060 TTTCATTATGGCTGTATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198942403 Original CRISPR AATATTTTTAAAGCCTTCTA GGG (reversed) Intergenic
No off target data available for this crispr