ID: 1198942406

View in Genome Browser
Species Human (GRCh38)
Location X:141971034-141971056
Sequence TATTTTTCATTATGGCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198942399_1198942406 9 Left 1198942399 X:141971002-141971024 CCATCTATCCCATCCCTAGAAGG No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data
1198942402_1198942406 0 Left 1198942402 X:141971011-141971033 CCATCCCTAGAAGGCTTTAAAAA No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data
1198942401_1198942406 1 Left 1198942401 X:141971010-141971032 CCCATCCCTAGAAGGCTTTAAAA No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data
1198942403_1198942406 -4 Left 1198942403 X:141971015-141971037 CCCTAGAAGGCTTTAAAAATATT No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data
1198942404_1198942406 -5 Left 1198942404 X:141971016-141971038 CCTAGAAGGCTTTAAAAATATTT No data
Right 1198942406 X:141971034-141971056 TATTTTTCATTATGGCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198942406 Original CRISPR TATTTTTCATTATGGCTGTA TGG Intergenic
No off target data available for this crispr