ID: 1198944425

View in Genome Browser
Species Human (GRCh38)
Location X:141994981-141995003
Sequence TATTCCAAACCAAAGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198944425_1198944436 24 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944436 X:141995028-141995050 CCAACAAGGAATCTGGAGTGGGG No data
1198944425_1198944437 28 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944437 X:141995032-141995054 CAAGGAATCTGGAGTGGGGCTGG No data
1198944425_1198944431 17 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG No data
1198944425_1198944429 10 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944429 X:141995014-141995036 AGTGCCATTTTGTCCCAACAAGG No data
1198944425_1198944432 22 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944432 X:141995026-141995048 TCCCAACAAGGAATCTGGAGTGG No data
1198944425_1198944438 29 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944438 X:141995033-141995055 AAGGAATCTGGAGTGGGGCTGGG No data
1198944425_1198944434 23 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944434 X:141995027-141995049 CCCAACAAGGAATCTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198944425 Original CRISPR TATTCCAAACCAAAGGGAAC TGG (reversed) Intergenic
No off target data available for this crispr