ID: 1198944427

View in Genome Browser
Species Human (GRCh38)
Location X:141994988-141995010
Sequence CAGAGAATATTCCAAACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198944427_1198944438 22 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944438 X:141995033-141995055 AAGGAATCTGGAGTGGGGCTGGG No data
1198944427_1198944432 15 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944432 X:141995026-141995048 TCCCAACAAGGAATCTGGAGTGG No data
1198944427_1198944434 16 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944434 X:141995027-141995049 CCCAACAAGGAATCTGGAGTGGG No data
1198944427_1198944429 3 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944429 X:141995014-141995036 AGTGCCATTTTGTCCCAACAAGG No data
1198944427_1198944431 10 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG No data
1198944427_1198944436 17 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944436 X:141995028-141995050 CCAACAAGGAATCTGGAGTGGGG No data
1198944427_1198944437 21 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944437 X:141995032-141995054 CAAGGAATCTGGAGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198944427 Original CRISPR CAGAGAATATTCCAAACCAA AGG (reversed) Intergenic
No off target data available for this crispr