ID: 1198944431

View in Genome Browser
Species Human (GRCh38)
Location X:141995021-141995043
Sequence TTTTGTCCCAACAAGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198944425_1198944431 17 Left 1198944425 X:141994981-141995003 CCAGTTCCCTTTGGTTTGGAATA No data
Right 1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG No data
1198944426_1198944431 11 Left 1198944426 X:141994987-141995009 CCCTTTGGTTTGGAATATTCTCT No data
Right 1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG No data
1198944427_1198944431 10 Left 1198944427 X:141994988-141995010 CCTTTGGTTTGGAATATTCTCTG No data
Right 1198944431 X:141995021-141995043 TTTTGTCCCAACAAGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198944431 Original CRISPR TTTTGTCCCAACAAGGAATC TGG Intergenic
No off target data available for this crispr