ID: 1198944747

View in Genome Browser
Species Human (GRCh38)
Location X:141998091-141998113
Sequence ATTCCATTTGCAAAAGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198944746_1198944747 1 Left 1198944746 X:141998067-141998089 CCTTCGTGATATTTCTTGAATAT No data
Right 1198944747 X:141998091-141998113 ATTCCATTTGCAAAAGTTAAAGG No data
1198944745_1198944747 2 Left 1198944745 X:141998066-141998088 CCCTTCGTGATATTTCTTGAATA No data
Right 1198944747 X:141998091-141998113 ATTCCATTTGCAAAAGTTAAAGG No data
1198944744_1198944747 3 Left 1198944744 X:141998065-141998087 CCCCTTCGTGATATTTCTTGAAT No data
Right 1198944747 X:141998091-141998113 ATTCCATTTGCAAAAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198944747 Original CRISPR ATTCCATTTGCAAAAGTTAA AGG Intergenic
No off target data available for this crispr