ID: 1198946720 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:142024330-142024352 |
Sequence | TCACATGTGCAGGAGAAAGA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1198946720_1198946727 | 28 | Left | 1198946720 | X:142024330-142024352 | CCGTCTTTCTCCTGCACATGTGA | No data | ||
Right | 1198946727 | X:142024381-142024403 | CCATGATTGTAAGTTTCCTGAGG | 0: 5548 1: 8228 2: 6830 3: 4292 4: 3006 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1198946720 | Original CRISPR | TCACATGTGCAGGAGAAAGA CGG (reversed) | Intergenic | ||
No off target data available for this crispr |