ID: 1198946720

View in Genome Browser
Species Human (GRCh38)
Location X:142024330-142024352
Sequence TCACATGTGCAGGAGAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198946720_1198946727 28 Left 1198946720 X:142024330-142024352 CCGTCTTTCTCCTGCACATGTGA No data
Right 1198946727 X:142024381-142024403 CCATGATTGTAAGTTTCCTGAGG 0: 5548
1: 8228
2: 6830
3: 4292
4: 3006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198946720 Original CRISPR TCACATGTGCAGGAGAAAGA CGG (reversed) Intergenic
No off target data available for this crispr