ID: 1198947674

View in Genome Browser
Species Human (GRCh38)
Location X:142032232-142032254
Sequence AGGGAGAATGCAGTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198947674_1198947678 10 Left 1198947674 X:142032232-142032254 CCTACAATCACTGCATTCTCCCT No data
Right 1198947678 X:142032265-142032287 CACCAATTCTCCACACCACATGG No data
1198947674_1198947681 21 Left 1198947674 X:142032232-142032254 CCTACAATCACTGCATTCTCCCT No data
Right 1198947681 X:142032276-142032298 CACACCACATGGTTGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198947674 Original CRISPR AGGGAGAATGCAGTGATTGT AGG (reversed) Intergenic
No off target data available for this crispr