ID: 1198964935

View in Genome Browser
Species Human (GRCh38)
Location X:142217384-142217406
Sequence CCTCTACTTCCATCACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964935_1198964942 5 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964942 X:142217412-142217434 CTCCTTCCGCATTTTGGCTAGGG No data
1198964935_1198964941 4 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964941 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data
1198964935_1198964946 24 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964935_1198964947 25 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964947 X:142217432-142217454 GGGAGATTCCAGTGATGGTAGGG No data
1198964935_1198964938 -1 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964938 X:142217406-142217428 GCCTACCTCCTTCCGCATTTTGG No data
1198964935_1198964945 20 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964935 Original CRISPR CCTCTACTTCCATCACCTGT GGG (reversed) Intergenic
No off target data available for this crispr