ID: 1198964937

View in Genome Browser
Species Human (GRCh38)
Location X:142217385-142217407
Sequence GCCTCTACTTCCATCACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964937_1198964946 23 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964937_1198964947 24 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964947 X:142217432-142217454 GGGAGATTCCAGTGATGGTAGGG No data
1198964937_1198964942 4 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964942 X:142217412-142217434 CTCCTTCCGCATTTTGGCTAGGG No data
1198964937_1198964945 19 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data
1198964937_1198964938 -2 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964938 X:142217406-142217428 GCCTACCTCCTTCCGCATTTTGG No data
1198964937_1198964941 3 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964941 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964937 Original CRISPR GCCTCTACTTCCATCACCTG TGG (reversed) Intergenic