ID: 1198964938

View in Genome Browser
Species Human (GRCh38)
Location X:142217406-142217428
Sequence GCCTACCTCCTTCCGCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964932_1198964938 25 Left 1198964932 X:142217358-142217380 CCTGACTGGGAAGTGGTGACAGA No data
Right 1198964938 X:142217406-142217428 GCCTACCTCCTTCCGCATTTTGG No data
1198964937_1198964938 -2 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964938 X:142217406-142217428 GCCTACCTCCTTCCGCATTTTGG No data
1198964935_1198964938 -1 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964938 X:142217406-142217428 GCCTACCTCCTTCCGCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964938 Original CRISPR GCCTACCTCCTTCCGCATTT TGG Intergenic
No off target data available for this crispr