ID: 1198964941

View in Genome Browser
Species Human (GRCh38)
Location X:142217411-142217433
Sequence CCTCCTTCCGCATTTTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964937_1198964941 3 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964941 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data
1198964935_1198964941 4 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964941 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data
1198964932_1198964941 30 Left 1198964932 X:142217358-142217380 CCTGACTGGGAAGTGGTGACAGA No data
Right 1198964941 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964941 Original CRISPR CCTCCTTCCGCATTTTGGCT AGG Intergenic
No off target data available for this crispr