ID: 1198964943

View in Genome Browser
Species Human (GRCh38)
Location X:142217414-142217436
Sequence CTCCCTAGCCAAAATGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964943_1198964945 -10 Left 1198964943 X:142217414-142217436 CCTTCCGCATTTTGGCTAGGGAG No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data
1198964943_1198964947 -5 Left 1198964943 X:142217414-142217436 CCTTCCGCATTTTGGCTAGGGAG No data
Right 1198964947 X:142217432-142217454 GGGAGATTCCAGTGATGGTAGGG No data
1198964943_1198964946 -6 Left 1198964943 X:142217414-142217436 CCTTCCGCATTTTGGCTAGGGAG No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964943 Original CRISPR CTCCCTAGCCAAAATGCGGA AGG (reversed) Intergenic
No off target data available for this crispr