ID: 1198964944

View in Genome Browser
Species Human (GRCh38)
Location X:142217418-142217440
Sequence GAATCTCCCTAGCCAAAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964944_1198964946 -10 Left 1198964944 X:142217418-142217440 CCGCATTTTGGCTAGGGAGATTC No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964944_1198964947 -9 Left 1198964944 X:142217418-142217440 CCGCATTTTGGCTAGGGAGATTC No data
Right 1198964947 X:142217432-142217454 GGGAGATTCCAGTGATGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964944 Original CRISPR GAATCTCCCTAGCCAAAATG CGG (reversed) Intergenic
No off target data available for this crispr