ID: 1198964945

View in Genome Browser
Species Human (GRCh38)
Location X:142217427-142217449
Sequence GGCTAGGGAGATTCCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964937_1198964945 19 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data
1198964935_1198964945 20 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data
1198964943_1198964945 -10 Left 1198964943 X:142217414-142217436 CCTTCCGCATTTTGGCTAGGGAG No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data
1198964940_1198964945 -7 Left 1198964940 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data
1198964939_1198964945 -3 Left 1198964939 X:142217407-142217429 CCTACCTCCTTCCGCATTTTGGC No data
Right 1198964945 X:142217427-142217449 GGCTAGGGAGATTCCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964945 Original CRISPR GGCTAGGGAGATTCCAGTGA TGG Intergenic
No off target data available for this crispr