ID: 1198964946

View in Genome Browser
Species Human (GRCh38)
Location X:142217431-142217453
Sequence AGGGAGATTCCAGTGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198964939_1198964946 1 Left 1198964939 X:142217407-142217429 CCTACCTCCTTCCGCATTTTGGC No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964937_1198964946 23 Left 1198964937 X:142217385-142217407 CCACAGGTGATGGAAGTAGAGGC No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964944_1198964946 -10 Left 1198964944 X:142217418-142217440 CCGCATTTTGGCTAGGGAGATTC No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964943_1198964946 -6 Left 1198964943 X:142217414-142217436 CCTTCCGCATTTTGGCTAGGGAG No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964935_1198964946 24 Left 1198964935 X:142217384-142217406 CCCACAGGTGATGGAAGTAGAGG No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data
1198964940_1198964946 -3 Left 1198964940 X:142217411-142217433 CCTCCTTCCGCATTTTGGCTAGG No data
Right 1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198964946 Original CRISPR AGGGAGATTCCAGTGATGGT AGG Intergenic
No off target data available for this crispr