ID: 1198966424

View in Genome Browser
Species Human (GRCh38)
Location X:142232259-142232281
Sequence CTCCTTAGGGACTCTCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198966416_1198966424 25 Left 1198966416 X:142232211-142232233 CCCTTTTAAAGTAAATAAATAAT No data
Right 1198966424 X:142232259-142232281 CTCCTTAGGGACTCTCTAATTGG No data
1198966417_1198966424 24 Left 1198966417 X:142232212-142232234 CCTTTTAAAGTAAATAAATAATC No data
Right 1198966424 X:142232259-142232281 CTCCTTAGGGACTCTCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198966424 Original CRISPR CTCCTTAGGGACTCTCTAAT TGG Intergenic
No off target data available for this crispr