ID: 1198966572

View in Genome Browser
Species Human (GRCh38)
Location X:142233458-142233480
Sequence GTGGCTGCTCAGAGGTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198966572_1198966575 22 Left 1198966572 X:142233458-142233480 CCAATAGACCTCTGAGCAGCCAC No data
Right 1198966575 X:142233503-142233525 CTAAGCAGTACTTGACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198966572 Original CRISPR GTGGCTGCTCAGAGGTCTAT TGG (reversed) Intergenic
No off target data available for this crispr