ID: 1198968233

View in Genome Browser
Species Human (GRCh38)
Location X:142250425-142250447
Sequence GCCTGTGTGTGGAGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198968229_1198968233 11 Left 1198968229 X:142250391-142250413 CCGGCAAGCACGTTCTCTGAATG No data
Right 1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198968233 Original CRISPR GCCTGTGTGTGGAGTGCAGA GGG Intergenic
No off target data available for this crispr