ID: 1198969133

View in Genome Browser
Species Human (GRCh38)
Location X:142261042-142261064
Sequence CAATCTAGGGGGCATGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198969128_1198969133 -8 Left 1198969128 X:142261027-142261049 CCGTGATTGATTGAGCAATCTAG No data
Right 1198969133 X:142261042-142261064 CAATCTAGGGGGCATGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198969133 Original CRISPR CAATCTAGGGGGCATGTGAC AGG Intergenic