ID: 1198974570

View in Genome Browser
Species Human (GRCh38)
Location X:142321866-142321888
Sequence GGGTGGAAGCAGAAGAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198974570_1198974577 7 Left 1198974570 X:142321866-142321888 CCCTAGTTCTTCTGCTTCCACCC No data
Right 1198974577 X:142321896-142321918 GGAGCTCTCTCCTGATACTTGGG No data
1198974570_1198974579 19 Left 1198974570 X:142321866-142321888 CCCTAGTTCTTCTGCTTCCACCC No data
Right 1198974579 X:142321908-142321930 TGATACTTGGGCCCTGCAGATGG No data
1198974570_1198974576 6 Left 1198974570 X:142321866-142321888 CCCTAGTTCTTCTGCTTCCACCC No data
Right 1198974576 X:142321895-142321917 TGGAGCTCTCTCCTGATACTTGG No data
1198974570_1198974580 25 Left 1198974570 X:142321866-142321888 CCCTAGTTCTTCTGCTTCCACCC No data
Right 1198974580 X:142321914-142321936 TTGGGCCCTGCAGATGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198974570 Original CRISPR GGGTGGAAGCAGAAGAACTA GGG (reversed) Intergenic
No off target data available for this crispr