ID: 1198979820

View in Genome Browser
Species Human (GRCh38)
Location X:142381976-142381998
Sequence GCAATGAAGACTAACTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198979820_1198979825 20 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979825 X:142382019-142382041 GGGAGGTAATTAGATCATGAGGG 0: 24
1: 274
2: 2104
3: 9414
4: 14435
1198979820_1198979823 3 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979823 X:142382002-142382024 AGTGCTGTCAGACTTTTGGGAGG No data
1198979820_1198979824 19 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979824 X:142382018-142382040 TGGGAGGTAATTAGATCATGAGG 0: 41
1: 793
2: 7265
3: 13151
4: 14308
1198979820_1198979822 0 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979822 X:142381999-142382021 AACAGTGCTGTCAGACTTTTGGG No data
1198979820_1198979826 28 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979826 X:142382027-142382049 ATTAGATCATGAGGGCTTTGTGG No data
1198979820_1198979821 -1 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979821 X:142381998-142382020 CAACAGTGCTGTCAGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198979820 Original CRISPR GCAATGAAGACTAACTTTCC CGG (reversed) Intergenic
No off target data available for this crispr