ID: 1198979821

View in Genome Browser
Species Human (GRCh38)
Location X:142381998-142382020
Sequence CAACAGTGCTGTCAGACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198979819_1198979821 14 Left 1198979819 X:142381961-142381983 CCACAAAATTCATGTCCGGGAAA No data
Right 1198979821 X:142381998-142382020 CAACAGTGCTGTCAGACTTTTGG No data
1198979818_1198979821 15 Left 1198979818 X:142381960-142381982 CCCACAAAATTCATGTCCGGGAA No data
Right 1198979821 X:142381998-142382020 CAACAGTGCTGTCAGACTTTTGG No data
1198979820_1198979821 -1 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979821 X:142381998-142382020 CAACAGTGCTGTCAGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198979821 Original CRISPR CAACAGTGCTGTCAGACTTT TGG Intergenic