ID: 1198979824

View in Genome Browser
Species Human (GRCh38)
Location X:142382018-142382040
Sequence TGGGAGGTAATTAGATCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198979820_1198979824 19 Left 1198979820 X:142381976-142381998 CCGGGAAAGTTAGTCTTCATTGC No data
Right 1198979824 X:142382018-142382040 TGGGAGGTAATTAGATCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198979824 Original CRISPR TGGGAGGTAATTAGATCATG AGG Intergenic