ID: 1198982663

View in Genome Browser
Species Human (GRCh38)
Location X:142417052-142417074
Sequence CTAGTCCAGCAGTTGTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198982663_1198982664 -6 Left 1198982663 X:142417052-142417074 CCAAAAGACAACTGCTGGACTAG No data
Right 1198982664 X:142417069-142417091 GACTAGAGAATTTCCACTTAAGG No data
1198982663_1198982669 21 Left 1198982663 X:142417052-142417074 CCAAAAGACAACTGCTGGACTAG No data
Right 1198982669 X:142417096-142417118 TTTATTGGCATGTTATGGAATGG No data
1198982663_1198982665 -5 Left 1198982663 X:142417052-142417074 CCAAAAGACAACTGCTGGACTAG No data
Right 1198982665 X:142417070-142417092 ACTAGAGAATTTCCACTTAAGGG No data
1198982663_1198982666 6 Left 1198982663 X:142417052-142417074 CCAAAAGACAACTGCTGGACTAG No data
Right 1198982666 X:142417081-142417103 TCCACTTAAGGGACATTTATTGG No data
1198982663_1198982668 16 Left 1198982663 X:142417052-142417074 CCAAAAGACAACTGCTGGACTAG No data
Right 1198982668 X:142417091-142417113 GGACATTTATTGGCATGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198982663 Original CRISPR CTAGTCCAGCAGTTGTCTTT TGG (reversed) Intergenic
No off target data available for this crispr